1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
professor190 [17]
3 years ago
7

Red-green color blindness is a recessively inherited disorder that affects 7% of the male population but only 0.4% of the female

population. Given what you know about disease inheritance and gender determination, why do you think color blindness is so much more common in men than women?
Biology
1 answer:
Vesnalui [34]3 years ago
5 0

Answer:

Men express all the X-linked genes present in their genome.

Explanation:

Human males have one copy of X and one copy of Y chromosomes. They express all the alleles present on their X chromosome irrespective of its dominant or recessive nature. This occurs because males do not have a second copy of the X chromosome to carry another allele for the same gene. Color blindness is caused by a recessive allele present on the X chromosome. Males carrying one copy of this allele exhibit the disease while females need two copies of the allele of color blindness to express the disease. Therefore, males are more frequently affected by this disease.

You might be interested in
What's a success you have had this week?
exis [7]

Answer:

I got to the next level on brainly

8 0
3 years ago
Read 2 more answers
 The formation of hurricanes, storms, and other weather events require energy. The original energy source for all of these event
DENIUS [597]
What are your answer choices? i would say wave energy
7 0
3 years ago
Read 2 more answers
What are volcanoes and describes the type of volcanoes
Pani-rosa [81]
a volcano is a mountain or hill, typically conical, having a crater or vent through which lava, rock fragments, hot vapor, and gas are being or have been erupted from the earth's crust.

There are three main types of volcano - composite or strato,shield and dome. Composite volcanoes, sometimes known as strato volcanoes, are steep sided cones formed from layers of ash and [lava] flows. The eruptions from these volcanoes may be a pyroclastic flow rather than a flow of lava.
6 0
3 years ago
Read 2 more answers
How does energy from the sun affect the motion of molecules in a gas compared to molecules in a liquid?
Lelu [443]
The molecuels in liquid moves slower than the ones in the sun
3 0
3 years ago
3. How does the salinity in water change as you move from inland areas out towards the ocean? Be sure to include the phrase "bra
Len [333]

Answer:

Explanation below.

Explanation:

3. The salinity of water increases as the water moves from the inland area to the ocean. This is because the ocean has high salinity.

Salinity is the amount or concentration of salt in the water.

WAYS BY WHICH ESTUARIES PROTECT THE INLAND AREAS

1. The plant in estuaries prevent shoreline erosion.

2. Protect the inland areas from flooding.

3. Protect the inland areas from storm surges from hurricane.

IMPORTANCE OF ESTUARIES TO INLAND PEOPLE AND WILDLIFE.

1. They provide nesting and feeding habits for many aquatic plants and animals.

2. Provide goals and services that are economically and ecologically indispensable.

3. Prevent shoreline erosion

4. Protect the inland areas from flooding.

IMPACTS OF DREDGING ON FISH LIVING ESTUARIES.

Dredging have negative impacts on the organisms in estuaries. These are

1. Habitat degradation

2. Remobilization of contaminants

3. Increase rate of sedimentation.

4. Increased the concentration of suspended matter.

8 0
3 years ago
Other questions:
  • The Calvin cycle is considered light-independent because it can occur in darkness. However, most often the Calvin cycle takes pl
    7·1 answer
  • Which animal is manufacture their own food?
    15·1 answer
  • True or false<br>many trials are not needed before a hypothesis can be accepted as true
    10·2 answers
  • Which of the following organelles can best be compared to a post office ?
    8·1 answer
  • A researcher analyzes the DNA in a mango plant and determines that guanine makes up 20 percent of the bases in the DNA. What is
    11·1 answer
  • 3. What types of damage can<br> introduced species cause?
    13·1 answer
  • Which would a diet low in carbohydrates most likely promote? *
    11·2 answers
  • Find the measure of 3.
    5·1 answer
  • What are two reasons that few large plants grow beneath the trees of a coniferous forest?
    14·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!