1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
2 years ago
11

Which type of teeth do mammals use for grinding plants?

Biology
1 answer:
Bond [772]2 years ago
4 0
I think the answer is molars
You might be interested in
HELP QUIZ DUE TONIGHT!!!!!!!!!!!
denis23 [38]

Answer:

this is for the first image with the marshmallows in campfire-There are two main processes that heat a marshmallow: absorption of campfire radiation photons and contact with very hot air rising off the fire convection. If we place the marshmallow directly above the fire, we get both.

5 0
2 years ago
The bones in whales flipper are the same as the bones in a dog front leg. What does that tell you about the two organisms?
stepan [7]
It tells you that they descended from a common ancestor.
6 0
3 years ago
A large number of disease-free individuals were enrolled in a study
Nuetrik [128]

Answer:

a,Answer: Type I right censoring, censoring time = 60.

b.This is called an Interval censoring,

c.this is called Random censoring because the year in consideration was chosen at random, censoring time = 61.

d.The observations are left truncated respectively at age 30, 40, 50 and 42.

e.L\alpha \frac{S(60)}{S(30)} *\frac{S(52)-S(55)}{S(40)} *\frac{S(61)}{S(42)} *\frac{S(55)}{S(50)}

Explanation:

a) A healthy individual, enrolled in the study at age 30, never developed

breast cancer during the study.

Answer: Type I censoring, censoring time = 60.

(b) A healthy individual, enrolled in the study at age 40, was diagnosed

with breast cancer at the fifth exam after enrollment (i.e., the disease

started sometime between 12 and 15 years after enrollment).

THis is called an Interval censoring,

if the clinical exams is conducted every three years , then 3*4=12, and 3*5=15

add this to 40 years respectively, we have

censoring time = (52, 55]

c) A healthy individual, enrolled in the study at age 50, died from a

cause unrelated to the disease (i.e., not diagnosed with breast cancer

at any time during the study) at age 61.

this is called Random censoring because the year in consideration was chosen at random, censoring time = 61.

(d) An individual, enrolled in the study at age 42, moved away from

the community at age 55 and was never diagnosed with breast cancer

during the period of observation.

Random censoring, censoring time = 55.

The observations are left truncated respectively at age 30, 40, 50 and 42.

e.  Confining your attention to the four individuals described above,

write down the likelihood for this portion of the study.

L\alpha \frac{S(60)}{S(30)} *\frac{S(52)-S(55)}{S(40)} *\frac{S(61)}{S(42)} *\frac{S(55)}{S(50)}  

the above represent the likelihood

3 0
3 years ago
What species are currently evolving for aquatic environments?
Fofino [41]

Answer: Hello Luv.......

How whales and dolphins evolved for life at sea ... important ways to allow these animals to transition from terrestrial to aquatic environments.

Explanation:

From tropical corals to tawny owls, some species are already being pushed to ... For instance, an experiment growing brewer's yeast in environments with deadly ... Before there was "Climate Change" there was STILL evolution. ... and Horses Dig Wells That Provide Water for a Host of Desert Species.

Hope this helps.

Mark me brainest please...

Anna ♥

3 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Evolution _____.
    10·1 answer
  • Which of the following methods might be used to decrease the rate of approach to carrying capacity by the developed world?
    12·1 answer
  • A good model of the cell membrane would be
    10·1 answer
  • Which of the following is most likely to result from a damaged nerve?
    7·2 answers
  • You ride your skateboard to school and tell all your friends you rode at a speed of 25 mph. They know this cannot he true becaus
    13·1 answer
  • A DNA mutation changes the shape of the extracellular domain of transmembrane receptor protein A produced by the cell. Which of
    7·1 answer
  • Why can males only have a y-linked trait?
    8·1 answer
  • What causes wind?
    7·2 answers
  • In the essay box below, submit any observations you made, as well as the answers to the questions above. Then write a summary pa
    8·2 answers
  • If everyone on the planet used the same amount of resources as an average American, what percent of the Earth would need to be u
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!