1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
astra-53 [7]
3 years ago
6

What times 3 equals 24

Mathematics
2 answers:
Rom4ik [11]3 years ago
7 0
24 divided by 3 equals 8
Stells [14]3 years ago
6 0
3 x 8 = 24
 8,16,24
3,6,9,12,15,18,21,24
You might be interested in
2) university theater sold 556 tickets for a play. tickets cost $22 per adultand $12 per senior citizen. if total receipts were
harina [27]
About 708 or 707.6666666667
7 0
2 years ago
Full‐me Ph.D. students receive an average of $12,837 per year. If the
Pavlova-9 [17]

Answer:

.0022

Step-by-step explanation:

6 0
1 year ago
Tysm 30 points!! pls answer correctly
ira [324]
The answer is 4 pensioners
5 0
2 years ago
Read 2 more answers
Which is the graph of x – y = 1?
Jet001 [13]

Answer:

its the second graph

Step-by-step explanation:

you could use this website to find out graph

desmos calculator

5 0
3 years ago
The graph shows the amount of money paid when purchasing bags of candy at the zoo:
Oliga [24]
The answer is 4$ hope this helps
5 0
2 years ago
Read 2 more answers
Other questions:
  • In a fruit cocktail, for every 28 ml of orange juice you need 14 ml of apple juice and 56 ml of coconut milk. What is the ratio
    15·1 answer
  • Find the distance between each pair of parallel lines with the given equations y=5x-22 y=5x+4
    5·1 answer
  • A Weather Forecaster, predicts that their is a 50% chance of rain on Saturday and a 40% chance of rain on Sunday. If these proba
    6·1 answer
  • what is the area of the combined rectangles that is used in 9 feet 5 feet 5 feet 7 feet by 14 feet and 12 feet
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • ***DO SOON***Please solve. Can't figure it out for the life of me and I need to finish his test. Thank you!
    10·1 answer
  • Help Plz
    13·2 answers
  • Find the mean of the day 10.25‚9‚4.75‚8‚2.65‚12‚2.35​
    10·1 answer
  • What is the measure of the angle that is complementary to the given angle?
    8·1 answer
  • Will give brainliest need help asap
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!