1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dexar [7]
3 years ago
12

Which organisms transform nitrogen to a form that is useful to plants

Biology
1 answer:
vekshin13 years ago
6 0
I think it’s bacteria
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
a man with hemophilia, which is a sex-linked recessive disease, lives a full life through modern medicine. he eventually marries
GarryVolchara [31]

All of his offspring will be free of the disease, assuming his wife is not a carrier.

The phenotype of an organism is a collection of its observable traits or characteristics. The term describes the physical form and structure of an organism as well as its physiological and biochemical traits, behavior, and results of that behavior. The blood clots incorrectly as a result of hemophilia, a genetic bleeding disorder. Both spontaneous bleeding and bleeding after an injury or surgery may result from this. Numerous clotting proteins found in blood can help to stop bleeding. Blood clotting is impaired by a rare disorder called hemophilia. It happens as a result of the body not producing enough of a protein called a clotting factor. Clotting aids in stopping the bleeding after an injury or accident. In the absence of coagulation, bleeding may be excessively simple or prolonged. There is currently no known cure for hemophilia, despite the fact that treatment for those with the condition has significantly improved over the past few decades.

To learn more about phenotype: brainly.com/question/902712

#SPJ4

8 0
1 year ago
Use the transparency to describe a food chain that includes a mountain lion and a shrub
Rudiy27

Answer and Explanation:

We know that shrubs are primary producers and mountain lions are secondary or tertiary consumers. Therefore, mountain lion cannot directly feed on shrub rather need a herbivore. Therefore, to develop a food chain including mountain lion and shrub, we need to have at least one herbivore. If we add a deer between these two, the food chain willl be complete. The deer (herbivore) will eat shrub and mountain lion (carnivore) will eat deer. The food chain can be written as follows

<em>Shrub -> deer -> Mountain Lion</em>

5 0
3 years ago
What structure is required for an eukaryotic organism to be classified as an autotroph?
lara [203]

Answer:

Chloroplast

Explanation:

This organelle in cells indicates that an organism can harness energy from the sun and other abiotic factors like carbon dioxide to make their own ‘food’. Chroloplasts have chlorophyl piments that contains photosystems centers that harness energy from the sun for photosynthesis. This light energy from the sun is captured and transferred in chemical bonds of manufactured carbohydrates which are stored in the plants. These plants transfer this energy in an ecosystem when they are consumed by higher organisms in the food chain.

4 0
3 years ago
Select ALL the correct descriptions that help to define luminosity.
wolverine [178]

Answer:

A, Band C

Explanation:

Hopefully this helps

8 0
3 years ago
Other questions:
  • Imagine that the membranes in parts A and B make up the wall of the human heart or the wall of a blood vessel. Based on what you
    14·1 answer
  •  Around the globe, cultural factors influence family size and as a result, affect population growth rate. Many of these cultural
    14·1 answer
  • Place the mouse, fruit fly, duck, and gorilla in order of their relatedness to humans, from least related to most
    15·2 answers
  • What possible reason(s) might explain why the yield goes up when you remove trees?
    8·1 answer
  • Producers do _____ photosynthesis then cellular respiration.
    8·1 answer
  • Endurance athletes who exercise for long periods of time and consume only water may experience a sodium deficit in their extrace
    10·1 answer
  • The study of the interaction of organisms with each other and their environment involves non-living factors, also called _______
    5·2 answers
  • What process must take place prior to cell division to ensure the proper amount of dna in the resulting daughter cells
    9·1 answer
  • Which of these is evidence of global warming?
    12·1 answer
  • Why is the copernican revolution significant? select three options. few advancements in scientific knowledge were made. scientis
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!