1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dalvyx [7]
3 years ago
15

Why would cells lining a tube-like structure such as the trachea need to be ciliated?

Biology
1 answer:
Sphinxa [80]3 years ago
6 0
The cartilaginous structures<span> that ring most mammalian tracheae are ... The </span>trachea<span> is</span>lined<span> with a moist mucous-membrane layer composed of </span>cells<span> containing small hairlike projections called </span>cilia<span>. ... </span>Such<span> outgrowths could </span>have<span> been useful to insects exposed by the drying up of a temporary aquatic.

IMPORTANT! * MARK AS BRAINLIEST </span><span>ANSWER !!!! *</span>
You might be interested in
Iven the time constraints that emts often face as they assess and care for​ patients, the reassessment of the patient is usually
ollegr [7]
The reassessment of the patient is usually​ completed: in the ER
8 0
2 years ago
Can someone please help me with this i don’t know if it’s correct please help me
Nadya [2.5K]

Answer:

c. single bond

b. double bond

d. unsaturated fatty acid

The rest is right :)

Explanation:

"C" is a single bond because saturated fats only have single bonds (no double bonds!)

Unsaturated fatty acids, on the other hand, have a double bond, creating a bent shape.  

4 0
2 years ago
Transformation did not occur when dna was destroyed true or false
nikdorinn [45]
False dna will change every generation
7 0
3 years ago
Read 2 more answers
Please help, thanks!
Westkost [7]
The answer to your question is both C
3 0
3 years ago
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • In the context of psychosomatic medicine, Flanders Dunbar and Franz Alexander maintained that conflicts produce anxiety, which b
    6·1 answer
  • What is the naming system created by Linnaeus called
    6·1 answer
  • What is true of NAD in cellular respiration?
    5·1 answer
  • The nitrogen cycle has a large _____ component, while the phosphorus cycle has a large _____ component.
    6·1 answer
  • Just before you arrive on the scene of a medical call, you get more information from dispatch, which indicates "biting his tongu
    12·1 answer
  • You perform an experiment on two plants of the same species to find out what soil affects their growth the most. Both plants are
    13·1 answer
  • Word-of-mouth influence comes to consumers from family, colleagues, and ________.
    5·2 answers
  • Mitosis makes? sperm and egg cells. identical body cells. or all cells
    13·1 answer
  • I need the answer A$AP
    5·2 answers
  • If you could specialize yourself the way you want how would you make your self look
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!