1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paraphin [41]
3 years ago
6

Identify 3 things teenagers can do better then adults and explain why they’re able to

Biology
1 answer:
olya-2409 [2.1K]3 years ago
4 0
1-Be cute-Adult have wrinkles
2-Get bfs or gfs-Adults are too busy with working to pull
3-Be broke-Adults can make more money than teens
You might be interested in
L
bekas [8.4K]

Answer:

c

Explanation:

7 0
3 years ago
Which one of the following statements about the troposphere is
Dvinal [7]

Answer:

B. The tropospheric gases move becuase of convection currents.

Explanation:

The uneven heating of the regions of the troposphere by the sun ( the sun warms the air at the equator more than the air at the poles )causes convection currents, large-scale patterns of winds that move heat and moisture around the globe. In the Northern and Southern hemispheres, air rises along the equator and subpolar ( latitude about 50 to about 70 north and south ) climatic regions and sinks in the polar and subtropical regions. Air is deflected by the Earth's rotation as it moves between the poles and equator, creating belts of surface winds moving from east to west ( easterly winds ) in tropical and polar regions, the winds moving from west to east ( westerly winds ) in the middle latitudes. This global circulation is disrupted by the circular wind patterns of migrating high and low air pressure areas, plus locally abrupt changes in wind speed and direction known as turbulence.

6 0
3 years ago
Nonrandom mating tends to _______ the frequencies of ______ genotypes. increase; homozygous decrease; homozygous increase; heter
Solnce55 [7]
<span>The answer depends of the kind of non-randommating. If the non-random mating is the kind of positive assortative mating then it tends to increase the frequencies of homozygous genotypes. Positive assortative mating when individuals mate with other individuals like themselves. If the non-random mating is the kind of negative assortative mating, then the effect is the opposite as of the positive assortative mating, this is it tends to decrease the homozygous genotypes.</span>
8 0
3 years ago
Read 2 more answers
during which stage of the human life cycle does the body go through a series of changes to prepare for sexual reproduction?
Vaselesa [24]

Answer:

Puberty

Explanation:

5 0
3 years ago
Which type of organelle is primarily involved in the synthesis of oils, phospholipids, and steroids?
Viktor [21]
                                     bbbbbbbb
                                     b              b
                                     b                b
                                     b               b
                                     bbbbbbbb
                                     b               b
                                     b                  b
                                     b                    b
                                     b                     b
                                     b                    b
                                     bbbbbbbbbbb
7 0
3 years ago
Other questions:
  • PFK can be allosterically inhibited by ATP at high concentrations. Which of the following is the benefit of regulating glycolysi
    15·1 answer
  • Label the following terms in the following picture
    13·2 answers
  • You are studying a population of
    13·1 answer
  • Why a red blood cell burst when placed in water yet an onion epidermal cell does not?​
    13·1 answer
  • What type ofreproduction produces fungi that are different from either parent
    10·1 answer
  • Organ pembiakan jantan​
    9·1 answer
  • . Occurs at the full and new Moon phases; Earth, Moon, and Sun are in alignment pulling the water in the same direction A spring
    12·1 answer
  • First to get it right gets brainiest
    15·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Name three basic needs that organisms and cells share
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!