Translation would be the answer to that question
According to finding of scientist, the earth is roughly 4,600 million years old. then the non abundant fossil that they dated was about 3,600 million years old. so the fraction or percent of <span>geologic time is :
3,600 / 4600 = 0.78 or 78 % of earth geologic time</span>
<span>The question says, the corn we eat today is larger and has more kernels than the corn people first grew thousands of years ago. Which process is most likely responsible for the changes that have occurred. The correct option is 'succession'. Succession is the process by which change occur in the composition, structure or architecture of a specie over a period of time.</span>
Active transport is transport that takes energy. Osmosis is when a molecule is moving inside of a cell. Active transport is just moving a molecule through the cell membrane.
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
