1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eddi Din [679]
3 years ago
5

20 POINTS NEEED ASAP ON A TEST What are the similarities and differences in the way geologists and biologists approximate the ag

e of the earth?
Biology
2 answers:
frosja888 [35]3 years ago
8 0
The earth is only a few thousand years old. That’s a fact, plainly revealed in God’s Word. So we should expect to find plenty of evidence for its youth. And that’s what we find in the earth’s geology, biology, paleontology, and even astronomy.
r-ruslan [8.4K]3 years ago
4 0
Through radiometric dating. They take a physical object, and uses the breakdown or decay of atomic nuclei, termed radioactive decay, to date things of the age and rate of nucleus decay. They differ in fields or areas of study, and also differ in what they study.
You might be interested in
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
We think of our muscular system as the system that helps us move around. It also functions on an internal level by helping food
gogolik [260]

Out of these answer choices food only travels trough the D) Stomach; small intestines

6 0
3 years ago
Read 2 more answers
I’m an ecosystem which would have a larger population, producers or primary consumers
Vedmedyk [2.9K]

Answer:there would be a larger population of producers

Explanation:

Since there needs to be primary consumers, the population of producers needs to be plentiful in order for the primary consumers to survive.

7 0
3 years ago
Explain one adaptation that helps grasses succeed in grasslands
ehidna [41]

Answer:

Basal meristems

Explanation:

Meristems are the portion of plants able to generate any kind of new tissues. Therefore, the way plants keep their meristems protected is related to climate adaptation.

Grasslands tend to be arid ecosystems, so grasses have developed basal meristems, meaning they spend the dry season very close or under soil, where water evaporates slowlier than above surface, until wet season allows meristems to generate new stems and leaves.

This disposition is also useful in cases of fire and grazing, which are also frecuent in grasslands.

8 0
3 years ago
What role do producers play in the carbon cycle?
marishachu [46]
Producers synthesize their food through photosynthesis using energy from sunlight and carbon dioxide from the Air. Their respiration returns carbon dioxide to the atmosphere. Consumers use the food produced by producers for energy. Their respiration also returns carbon dioxide to the atmosphere.
8 0
3 years ago
Other questions:
  • Which statement is true about the process of accretion?
    7·2 answers
  • Deep-ocean waters flow in an overturning circulation called _______
    13·1 answer
  • !!!Please help!!! A group of students is studying convection currents. They fill two identical balloons with the same amount of
    14·1 answer
  • How does the hormone cholecystokinin (CCK) help in digestion?
    7·1 answer
  • In the heart, the pulmonary circulation circulates blood through the ________________, while the systemic circulation circulates
    6·2 answers
  • What did Both Martin Luther King Jr. and Ruby Bridges belive in and support
    13·1 answer
  • Why don't the present shapes of the continents fit perfectly into a supercontinent?
    15·1 answer
  • Besides hard and soft list two other that cold be used to divide nonliving things into two groups
    5·2 answers
  • Explain why tendons and ligaments are called connective tissue
    7·1 answer
  • ________ is a compound stored in the muscles to replenish atp stores.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!