1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Feliz [49]
3 years ago
11

What percentage of bills are made into laws each year?

Law
2 answers:
leva [86]3 years ago
8 0
It varies from year to years, but I would say about 6 percent. A very small amount 4-6% is passed each year.
Illusion [34]3 years ago
5 0

Answer:

4-6%

Explanation:

because most get passed

You might be interested in
Jean had just finished her Bachelor of Business Administration degree and wanted to put what she had learned to use. She started
stepan [7]

Based on the fact that Jean and Beverly manage different sections of the business, the business organization they operate is a Partnership.

<h3>What business are Jean and Beverly operating?</h3>

Jean and Beverly can be said to be operating the business of a partnership as both of them are in charge of separate parts of the business but work together for the company's success.

<h3>Which other type of business would suit them?</h3>

Another type of business organization that might suit Jean and Beverly is a limited liability company. The main advantage of this is that it puts their personal assets out of danger in case the company fails.

Unfortunately, their accounts will become public record as anyone can access it from the Companies House.

<h3 /><h3>What type of incorporation should they do?</h3>

Jean and Beverly may one day expand to other provinces so they should go for a federal incorporation to avoid the hassle of having to incorporate in every province they expand to.

Find out more on types of business ownerships at brainly.com/question/26356434

#SPJ1

5 0
2 years ago
When vulnerable roadway users have to travel in the main stream of traffic
SVETLANKA909090 [29]

Answer:

A

Explanation:

5 0
3 years ago
yall ever tried to then yo mom hit her and she gasp up right to him and shoot water screaming cheeto puff number 7. what would y
blsea [12.9K]

Answer:

lm.f.ao what? Further explain

Explanation:

8 0
3 years ago
What type of crime is motor vehicle theft?
Svetlanka [38]

C is the answer

Reason is because stealing someone's car is stealing their property

4 0
3 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • When someone pleads insanity, what two things must they submit to the court?
    14·2 answers
  • What is an example of globalization?​
    11·2 answers
  • Joan is a white-collar offender. She has been convicted of embezzlement and given a prison sentence. In terms of security levels
    5·1 answer
  • Which process does the US Supreme Court follow to make its decisions.
    6·2 answers
  • ¿Debe ser justo el derecho?
    12·1 answer
  • 2. What happened to savings in the United States? How did consumers contribute to this change?
    12·1 answer
  • Hi hurry pls :,)<br> in a short paragraph explain how case law and statutory law are interrelated.
    14·1 answer
  • Cómo se financia el gobierno
    5·1 answer
  • rue or False: If you are under the age of 18, your license can be suspended for six months to one year for the first offense.
    13·1 answer
  • What is the county government's role?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!