1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miskamm [114]
3 years ago
13

Select the correct answer.

Chemistry
1 answer:
Sholpan [36]3 years ago
5 0

Answer:

B.  Keq = 6.0 x 10-2.

Explanation:

Hello there!

In this case, according to the given information, it turns out possible for us to remember that any equilibrium constant is computed by dividing the concentration of products by that of reactants:

Keq=\frac{[Prod]}{[Reac]}

Thus, a reaction that is reactant-favored will have a Keq>1 because the concentration of reactants prevail over that of products at equilibrium, and thus, the correct answer is B.  Keq = 6.0 x 10-2.

Regards!

You might be interested in
Several properties of water are shown. Classify each property as a physical property or a chemical property.
34kurt

Chemical property:

  • Can be split into hydrogen and oxygen
  • Reacts with certain metals

Physical property:

  • Is liquid at room temperature
  • Has a density of 1.0 g/cm³
7 0
2 years ago
Pure sodium metal explodes when it makes contact with water. In its natural state, chlorine is a deadly, poisonous gas. When the
RideAnS [48]

https://do-work-zone.com/?mref=hello69

8 0
3 years ago
Read 2 more answers
Select the correct formula for the polyatomic ion.
Helga [31]
The poly atomic ion formula for ammonium would be NH4+
7 0
3 years ago
Read 2 more answers
A 93-L sample of dry air is cooled from 145 oC to -22 oC at a constant pressure of 2.85 atmospheres). What is the final volume?
Aloiza [94]

Answer: 55.84L

Explanation: Please see attachment for explanation.

3 0
2 years ago
How does the type of medium affect a sound wave? Give an Example
ivanzaharov [21]

Answer:

Sound waves need to travel through a medium such as solids, liquids and gases. The sound waves move through each of these mediums by vibrating the molecules in the matter. The molecules in solids are packed very tightly. Liquids are not packed as tightly.Of the three mediums (gas, liquid, and solid) sound waves travel the slowest through gases, faster through liquids, and fastest through solids. Temperature also affects the speed of sound.Sound waves in air (and any fluid medium) are longitudinal waves because particles of the medium through which the sound is transported vibrate parallel to the direction that the sound wave moves. A vibrating string can create longitudinal waves as depicted in the animation below.

Explanation:

4 0
2 years ago
Other questions:
  • In the lab, you mix two solutions (each originally at the same temperature) and the temperature of the resulting solution decrea
    12·1 answer
  • The Power powe and th
    10·1 answer
  • Which statement is true when a crystal is formed from many metal atoms? .A. There are no bands being formed.. B.There are many m
    11·2 answers
  • Fill in the blanka gas-like state of matter consisting of free electrons and atomic nuclei is __________
    15·1 answer
  • The monomer of poly(vinyl chloride) has the formula C2H3Cl. If there are 1,565 repeat units in a single chain of the polymer, wh
    7·1 answer
  • Will give brainliest!
    15·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • _______ are used because they're economical, easy to process, easy to transport, and the infrastructure exists for their storage
    15·1 answer
  • What is the mass number of silver
    11·2 answers
  • Why do thermistors increase in conductivity when heated? What happens in normal metals? Explain on the atomic level.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!