1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11111nata11111 [884]
3 years ago
12

. This type of monitoring tracks all the living things in an ecosystem what the name of this if you dont know dont answer

Biology
2 answers:
kiruha [24]3 years ago
5 0

Answer: terrestrial ecosystem or food chain

Explanation:

I am pretty positive but not completely sure this is the correct answer

Just want to help

kotykmax [81]3 years ago
3 0

Answer:

Food chain

Explanation:

You might be interested in
Why do scientists classify and organize organisms​
Ghella [55]

Scientists classify living things in order to organize and make sense of the incredible diversity of life. Modern scientists base their classifications mainly on molecular similarities. They group together organisms that have similar proteins and DNA.

hope this helps
8 0
3 years ago
What is a fossil and how can they be used to help unveil earth’s history
Firdavs [7]

Answer:

fossils are ancient bones or plants fossilized into rocks such as dinosaur bones(fossils) and they help unveil earths history by telling us more about them and what they might have looked like and big or small they were everything we know we know because of fossils

Explanation:

If brainiest is earned its greatly Appreciated

5 0
4 years ago
Orangutans are highly territorial primates. What is the most likely
ArbitrLikvidat [17]

Answer:

c

Explanation:

im just that good

8 0
3 years ago
Read 2 more answers
Maalox® manufactures several different types of antacid. Maalox® Extra Strength is a suspension. One teaspoon (5.00 cm3) contain
Elan Coil [88]

Answer:

Explanation:

find the answer below

3 0
3 years ago
What polysaccharide do plants store in plastids
Alik [6]
There are three common and principal types of polysaccharide, these are the cellulose, starch and glycogen. They are<span> all made by joining together molecules of glucose in different ways. 
</span><span>The polysaccharide that plants store in plastids is starch.</span>
4 0
3 years ago
Read 2 more answers
Other questions:
  • Parasitic bacteria that depend on eukaryotic host cells are
    13·1 answer
  • Which of the following kinds of cells eliminate their own waste material? * 1 point A)Plant cells, but not bacteria cells
    12·1 answer
  • Explain the statement “Population,not individuals,evolve
    15·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • How do lungs and airways compare among birds and mammals?
    8·1 answer
  • How many extinct species was man responsible for
    6·1 answer
  • Plz help!!!!<br> Answer
    14·1 answer
  • How is DNA copied (name)?
    11·1 answer
  • Which technological tool helps earth scientists gain new knowledge about earth’s subsurface?
    6·2 answers
  • If the order of base pairs in a DNA molecule is changed, what might occur?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!