Mitosis is a type of cell division<span> in which chromosomes number remains constant...mitosis helps in growth , repairing of wounds ,cell replacement, and asexual reproduction...</span>
Answer: b. Nutrients that leave the small intestine via blood are delivered first to the liver.
Explanation:
Lymph is a clear fluid that leeks out from the interstitial spaces of the cells and this comprises of electrolytes, blood proteins, and antibodies. It is pushed towards the heart from the lymphatic vessels. The nutrients from the small intestine are drained into the bloodstream and they are circulated to all parts of the body and not directly destined towards the liver.
Answer:
The light bends
Explanation:
As a result the different colors that make up white light become separated and into 6 other colors
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.