The answer is highlighted in bold: <span>ttttagccatttacgattaatcg.
This DNA template</span> is <span>written 5' to 3', just like it's supposed to be. The complementary strand also needs to be that way.
</span>
<span>5' ttttagccatttacgattaatcg 3' </span><span>the direction (--->)
3' ..</span>aatcg........................ 5' the direction (<---)
adenine (A) will bind with thymine (T) and guanine (G) will bond with cytosine (C).
Explanation:
Yams are produced through slips, which have been generated again from sprouts of mature yams, rather than seeds, as most other crops are. Split a yam in part and place one half in a bowl of cool water to develop sprouts.
Explanation:
3rd planet orbiting ba yellow dwarf star in the milky way galaxy