1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natulia [17]
3 years ago
13

Every year, the tropical rain forest has a rainy season. The forest floor floods, covering once dry areas with water. Some

Biology
1 answer:
Sveta_85 [38]3 years ago
4 0

Answer:

it is a disturbance because it drasticly changes the enviroment temeraraly disturbing the animals and forcing them to move

You might be interested in
Which of the statements regarding the cell cycle is true? Group of answer choices It is regulated by cyclins and CDKs. Different
MA_775_DIABLO [31]

Answer:

All of these choices are correct.

Explanation:

Cell cycle is the process of growth and division of cell. It comprises of interphase and mitosis. In interphase the cell grows, replicates its genomic content and prepares itself for division. In mitosis the division occurs.

Cell cycle is controlled by a group of kinases called as Cyclin dependent Kinases (CDKs). They act by phosphorylating their substrates. They are of various types like Cdk1, Cdk2, Cdk4 etc. They become active when they bind to a regulatory protein called cyclin. They are also of various types like Cyclin A, Cyclin B, Cyclin C etc. Level of cyclin and corresponding CDK increases and decreases according to the stage of cell cycle. For example in S phase of cell cycle concentration of cyclin A and E shoots up. CDK2 is able to bind to these cyclin molecules and hence it becomes active.

Cell cycle has major checkpoints where the condition of cell is analysed before it proceeds to the next stage of cycle. If any abnormality is detected, repair mechanism is activated or the cell is killed. Checkpoints do not allow cell cycle to proceed in damaged cells.

p53 is a tumor suppressor protein which can halt cell cycle when it detects some abnormality in cell. It usually acts in G1/S checkpoint (before the DNA replication starts in cell) and G2/M checkpoint (before the cell division begins). Hence, all of the above statements are true.

7 0
3 years ago
The genes in the DNA store information about how to manufacture proteins. If we think of these instructions like a chocolate chi
Lapatulllka [165]
D. choosing which type of chocolate to use
8 0
2 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Which particle has a high rate of deposition?
fenix001 [56]
The answer is a low-density particle
5 0
3 years ago
Read 2 more answers
Mycorrhizae are associations formed by fungi that grow on the roots of trees. These fungi penetrate into the roots of the trees.
seraphim [82]

Answer:Mutualism: both partners benefit

Explanation:

3 0
3 years ago
Other questions:
  • Can someone help me with this? Stem cells are used in which of the following types of biotechnologies?
    11·1 answer
  • Why was the founder species of finches on the Galapagos islands able to form such a large variation of beak types?
    15·1 answer
  • What are the images that occur when a visual sensation persists for a brief time even after the original stimulus are removed?
    8·1 answer
  • What conclusion can be drawn from the Theory of Plate Tectonics?
    12·1 answer
  • This can be found in the nucleus, and are tiny strands
    9·1 answer
  • Match the following strand of DNA with its complementary strand: C T T G A A C T G T A
    13·2 answers
  • Which characteristic does a baby giraffe inherit from its parent?
    11·2 answers
  • 15. A mountain divides a population. After many years the organisms show genetic differences from the original
    8·1 answer
  • Which describes the smallest basic unit of a substance that still displays the properties of that substance? Which describes the
    12·1 answer
  • The light-harvesting complexes of a chloroplast are located in the ________; the enzymes of the calvin cycle reactions are locat
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!