Answer:
Answer is explained in the explanation section below.
Explanation:
Solution:
Note: This question is incomplete and lacks very important data to solve this question. But I have found the similar question which shows the profiles about which question discusses. Using the data from that question, I have solved the question.
a) We need to find the major species from A to F.
Major Species at A:
1. 
Major Species at B:
1. 
2. 
Major Species at C:
1. 
Major Species at D:
1. 
2. 
Major Species at E:
1. 
Major Species at F:
1. 
b) pH calculation:
At Halfway point B:
pH = pK
+ log[
]/[H
]
pH = pK
= 6.35
Similarly, at halfway point D.
At point D,
pH = pK
+ log [H
]/[H2
]
pH = pK
= 10.33
Answer:
See below
Step-by-step explanation:
- Hydrogen either reacts with or is formed by reactions with many other elements, so chemists could use it directly to determine their relative masses.
- Hydrogen has the smallest atomic mass, so it was convenient to give H a relative atomic mass of 1 and assign those of other elements as multiples of this number.
The O = 16 scale became the standard in 1903 and carbon-12 was chosen in 1961.
The most accurate measurement is 1.1 g. Option A
<h3>What is accuracy?</h3>
The term accuracy refers to the fact that the measurement is close to the true value. The closer the measurement is to the true value as given, the more accurate it is.
In this case, the true value of the mass of the sample of calcium carbonate is 1.134 g. Now we have to look at all the masses of as obtained by Emma during the experiment.
The most accurate measurement is 1.1 g. Option A
Learn more about accuracy:brainly.com/question/15276983
#SPJ1
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Socratic helps for you page