1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GREYUIT [131]
3 years ago
11

In a 0.730 M solution, a weak acid is 12.5% dissociated. Calculate Ka of the acid.

Chemistry
1 answer:
Mamont248 [21]3 years ago
5 0

Answer:

Approximately 1.30 \times 10^{-2}, assuming that this acid is monoprotic.

Explanation:

Assume that this acid is monoprotic. Let \rm HA denote this acid.

\rm HA \rightleftharpoons H^{+} + A^{-}.

Initial concentration of \rm HA without any dissociation:

[{\rm HA}] = 0.730\; \rm mol \cdot L^{-1}.

After 12.5\% of that was dissociated, the concentration of both \rm H^{+} and \rm A^{-} (conjugate base of this acid) would become:

12.5\% \times 0.730\; \rm mol \cdot L^{-1} = 0.09125\; \rm mol \cdot L^{-1}.

Concentration of \rm HA in the solution after dissociation:

(1 - 12.5\%) \times 0.730\; \rm mol \cdot L^{-1} = 0.63875\; \rm mol\cdot L^{-1}.

Let [{\rm HA}], [{\rm H}^{+}], and [{\rm A}^{-}] denote the concentration (in \rm mol \cdot L^{-1} or \rm M) of the corresponding species at equilibrium. Calculate the acid dissociation constant K_{\rm a} for \rm HA, under the assumption that this acid is monoprotic:

\begin{aligned}K_{\rm a} &= \frac{[{\rm H}^{+}] \cdot [{\rm A}^{-}]}{[{\rm HA}]} \\ &= \frac{(0.09125\; \rm mol \cdot L^{-1}) \times (0.09125\; \rm mol \cdot L^{-1})}{0.63875\; \rm mol \cdot L^{-1}}\\[0.5em]&\approx 1.30 \times 10^{-2} \end{aligned}.

You might be interested in
I have no idea what to do please help me quickly!
Irina18 [472]

Answer:

The farther away the planet the slower the revolution around the earth. the closer the faster.

Explanation:

its like a tetherball pole when it wraps around it gets closer and spins faster and faster untill it stops. Brainliest?

6 0
3 years ago
Read 2 more answers
An object is acted upon by a force of 22 newtons to the right and a force of 13 newtons to the left. What is the magnitude and d
umka2103 [35]
22 Newton’s to the right but I’m not to sure make sure to check other answers!
5 0
4 years ago
At what temperature does a solid turn into a liquid
Lostsunrise [7]

Answer:

0°C

<h3>Hope this helps </h3><h3>Do mark as brainliest </h3>

6 0
4 years ago
Read 2 more answers
Imine formation from an aldehyde and an amine proceeds reversibly under slightly acidic conditions. The reaction is reversible d
Lostsunrise [7]

Answer:

Imine can be isolated from the reaction mixture as water is continuously removed from the reaction chamber

Explanation:

In this reaction, a non -aqueous solvent  is not used (not mentioned in the question). Thus, we can say that there is continuous removal water under suitable reacting conditions and hence the imine formed is left behind.

5 0
3 years ago
Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
inysia [295]

Answer:

Explanation:

Every A will be paired with a T, and every C with a G and vice versa (T to A, and G to C)

So the first letters in the sequence are ATGGG. So the pair will be TACCC.

4 0
3 years ago
Other questions:
  • How is energy passed along in the food chain and food web PLEASE HELP QUICK
    15·1 answer
  • Complete combustion of 4.10 g of a hydrocarbon produced 12.6 g of CO2 and 6.00 g of H2O. What is the empirical formula for the h
    12·1 answer
  • Water molecules are ____________ because the hydrogen atoms are positively charged on one end and the oxygen atoms are negativel
    11·1 answer
  • A tire at 21°C has a pressure of 0.82 atm. Its temperature decreases to –3.5°C. If there is no volume change in the tire, what i
    12·2 answers
  • an ice cube has a mass of 25 grams. the ice cube is placed in a glass and melts. What is true about the ice cube?
    7·1 answer
  • Which substance would have a ph close to 7?
    15·2 answers
  • According to Newton's Second Law of Motion, a decrease in mass will<br> increase acceleration
    7·2 answers
  • Positive oxidation number suggest that the element wants to ____ (lose/gain) electrons?
    11·1 answer
  • How many moles are in 8.7 x 104 atoms of oxygen?
    12·1 answer
  • Calculate the mass (in g) of anhydrous aluminum sulfate (MM = 342.15 g/mol) needed to make 250.0 mL of a 0.850 M Al3+ solution.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!