1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxandr [17]
2 years ago
15

A student flips a light switch but the light does not turn on. Based on this

Biology
2 answers:
Liula [17]2 years ago
6 0

Answer: the electrical wire is copper

Explanation:

Alinara [238K]2 years ago
4 0
Electrical wire is copper
You might be interested in
Describe how the colors you see would change if you were to dive from the surface to down deep in the ocean. What would things l
Luden [163]

Answer:

Answer is below.

Explanation:

First of all, it would be much darker the deeper you go. On the surface, the light from the sun touches the ocean, making the ocean look like a light blue. However, if you dive down even deeper, you will find a darker blue, and later nothing (the sun won't touch the deep parts of the ocean, so all you would see is darkness). The short answer to this is: It's lighter around the surface, and darker the deeper you dive down into the ocean.

hope this helps

Brainly is appreciated :)

5 0
3 years ago
What's the life cycle of an organism?
Anettt [7]
In biology, a life cycle<span> is a series of changes in form that an </span>organism<span> undergoes, returning to the starting state. "The concept is closely related to those of the </span>life<span>history, development and ontogeny, but differs from them in stressing renewal."</span>
5 0
3 years ago
Why do areas closer to bodies of water have different climates than do inland areas?
hram777 [196]
Temperature stays in warmer times, let go In colder times
5 0
2 years ago
If  you had a strand of DNA 100 base pairs long with 38 Adenine bases, how many Guanine nitrogenous bases would you have? E
quester [9]

Answer:If a DNA double helix is 100 nucleotide pairs long and contains 25 adenine bases, how many guanine bases does it contain? Well, we have to know the base pairs for DNA first. Adenine only bonds with thymine with two hydrogen bonds, while guanine only bonds with cytosine with three hydrogen bonds. Bonding pairs can also happen vice-versa.

Explanation:

can i get ya numba?

3 0
2 years ago
Read 2 more answers
Which class of Phylum Chordata includes animals with feathers and porous, lightweight bones?
Vikentia [17]

Answer:Vertebrates

I think the is the correct answer if it isn't i am so very sorry

3 0
2 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • What group of protein regulates cell division in eukaryotes
    10·1 answer
  • Which is not a combination of innate and learned behavior?
    14·1 answer
  • Nucleic acid a sequence of sugars, phosphates, and nitrogenous organic bases—dna and rna
    15·1 answer
  • Tom, a desert storm war veteran, has had nightmares and panic attacks for the past two and a half years. tom is most likely suff
    9·1 answer
  • What is natural selection?
    7·2 answers
  • Solomon is studying for class. To remember the term _____, he uses the analogy of a thermostat in a house. For instance, when th
    14·1 answer
  • 2. What biosecurity measures does the hatchery take?<br> Enter your answer
    8·1 answer
  • State two functions of mucus produced along the alimentary canal​
    10·1 answer
  • Each month when the sun, earth, and moon are in a straight line a<br> will occur.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!