1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnoma [55]
3 years ago
7

If someone does not get sufficient calories for quick energy what is most likely the next response the body will take?

Biology
1 answer:
vovangra [49]3 years ago
5 0

Answer:

Tiredness. The person feels tired

Explanation:

If you eat too little, you may not obtain as much energy as you need. This will make you feel tired

You might be interested in
Please help !! there are pictures and I need to put words in the boxes next to them that match. These are the words
erma4kov [3.2K]
Hay dndnnd dnnsnsnsjssjsj
5 0
3 years ago
.
ollegr [7]
I think the correct answer from the choices listed above is option A. <span>The type of soluble fiber found in oats, barley, lentils, split peas, and beans protects against heart disease. Hope this answers the question. Have a nice day.</span>
4 0
3 years ago
Read 2 more answers
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
An element's atomic number is 39. How many electrons would an atom of this element have?
Shkiper50 [21]
Im pretty sure the answer is 19
7 0
3 years ago
Read 2 more answers
Malaria parasite divides into many daughter individual simultaneously through multiple fission. State an advantage the parasite
Komok [63]

Answer:

The major characteristic feature  of asexual reproduction is the production of clones.Identical offspring with virtually similar DNA.Therefore,this is advantageous to the parasite because, the offspring or progeny produce are similar(clones), to the parent parasites,thus multiple reproduction can occur  when a single individual  parasites cells divisions.

Explanation:

6 0
3 years ago
Other questions:
  • *WILL GIVE BRAINLIEST AND 30 POINTS HELP FAST I HAVE A TIME LIMIT*
    10·1 answer
  • 6. How can we decrease the amount of atmospheric CO.?
    8·1 answer
  • What is your opinion of the balance of nature hypothesis? Would the deer on the island be better off, worse off, or about the sa
    7·2 answers
  • How does a birds beak help you identify its habitat
    13·1 answer
  • This hypothetical pedigree for a disease in humans illustrated inheritance that is
    7·1 answer
  • What are skeskeleton bones​
    13·2 answers
  • Explain how one of the earth’s natural processes is responsible for creating a natural resource.
    10·1 answer
  • Which statement most likely describes the daughter cells produced in the diagram
    9·1 answer
  • Are plants a source or sink of photosynthesis?
    10·1 answer
  • Ritika was hit by a football on our head but did not suffer from any serious injury explain the reason in 30 to 40 words​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!