1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rainbow [258]
3 years ago
8

Help me a sweet o the and get a thanks you and brainlessly

Biology
1 answer:
Paha777 [63]3 years ago
8 0
3 is A and 4 is A as well. I hope I’m right
You might be interested in
IN WHICH BIOME IS KNYSNA LOURIE,A BIRD,FOUND NATURALLY?
Eva8 [605]
Knysna Lourie is naturally found in mature evergreen forests of southern and eastern South Africa, and Swaziland. Although it can vary, and answer of a possible biome can be the Savannahs found in south Africa.
3 0
3 years ago
Some plants have stems called
inna [77]

Answer:

Runners

Explanation:

stems are usually upright and prop up the plant to gather sunlight, however, some stems grow along the ground. These stems are called runners and the plant itself is called a stolon. Runners are involved in asexual reproduction of plants. They have nodes along them which can grow into another plant.

8 0
3 years ago
Read 2 more answers
Caterpillars have hair-like bristles on the back side of their bodies. the bristles can be long or short. caterpillars with shor
tresset_1 [31]

Answer:110

Explanation: 220 x .5

7 0
3 years ago
if the object is in the top of the feild and you want to mpve it downward to the center, you would move the slide?
bogdanovich [222]
Downward towards yourself
7 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • What is the difference between the velocity and the speed of an object?
    9·1 answer
  • As energy flows through ecosystems, atoms and molecules cycle among what?
    15·1 answer
  • What do the different scientific theories about how life began on earth have in common
    13·1 answer
  • In what way are plants in a sunny meadow and sulfur bacteria in a deep sea vent alike
    9·2 answers
  • What is the factored form of the polynomial x2-12x+27​
    10·2 answers
  • Look at the DNA segment below. GATCGT Which of the segments below would be complementary to the segment above during DNA replica
    5·1 answer
  • Planets take in _ and release oxygen gas
    6·1 answer
  • What if the function of bio molecules in the cell cycle?
    9·2 answers
  • The answer is a right i hope this help guys
    9·1 answer
  • The most common causes of prehepatic jaundice are ________ and ineffective erythropoiesis.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!