Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Source of current, force and pathway.
Explanation:
Source of current, force and pathway are the three important things needed or responsible for the current flow. A supply of electric charges (electrons) which is provided by the electric source, force of push to move the charges through the circuit and a pathway on which current flows. Without these three things, flow of current is impossible. so we can say that the situation in which all these three things are present will allow the current to flow in the circuit.
Answer:
The correct answer is A DNA is replicated before mitosis begins
Explanation:
DNA replication is one of the most significant event of a cell cycle. .DNA replication occur in the S phase or synthesis phase of the cell cycle.
DNA is replicated once per cycle to maintain to normal chromosome number in daughter cells.
DNA is replicated to form two new DNA molecules which are then equally distributed in each daughter cell during the mitosis phase.
