1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vekshin1
3 years ago
9

Which of the following statements about hormone transport and distribution is not true? a. free hormone concentration is not inf

luenced by plasma protein concentration b. hormones bind to certain types of plasma proteins c. hormones can be transported bound to plasma protein or free in the plasma d. only free hormones can diffuse through capillary walls and bind to target tissues e. All of the statements are true.
Biology
1 answer:
adelina 88 [10]3 years ago
4 0
E . all of the statements are true hope i’m correct
You might be interested in
In the ocean, plants and other photosynthetic organisms take in carbon. This carbon is transferred through the food web into the
musickatia [10]

Answer:

C.  Oceans are carbon sinks because they store more carbon than they emit.

Explanation:

Oceans are carbon sinks because they store more carbon than they emit. Most of the carbon is produced in the respiration process as well as burning of fossil fuels. This carbon moves to the atmosphere and dissolved into the ocean which is required by the vegetation of ocean. Due to this carbon, vegetation produced more food for the organisms. About 25% of all CO2 emissions are absorbed by the ocean. Source is the part of a plant where materials are produced e.g. leaves whereas Sink refers to the part of the plant where the substrate can be stored e.g. roots or stem for starch.

6 0
3 years ago
How does the domain Eukarye differ from the other two domains?
miss Akunina [59]

Answer:

The Eukarya differ from the Archea and Bacteria in that their cells are eukaryotic, meaning they contain a membrane enclosed nucleus and other membrane enclosed organelles.

Explanation:

4 0
3 years ago
What is the difference between a food web and an interaction web?
Akimi4 [234]

Food web only contains interactions between trophic levels while an interaction web shows both trophic and non-trophic interactions.

7 0
3 years ago
Read 2 more answers
An intestinal hormone that stimulates parietal cells in the stomach is __________. secretin cholecystokinin enterokinase gastrin
Mariulka [41]
they are stimulated by gastrin
8 0
3 years ago
ou need to measure three things: 1. a quantity of water 2. the length of a leaf 3. the mass of a small stone Which unit of metri
Naddik [55]
Hey mate!
You stuck?

For a quantity of water, milliliters (mL) are used
For the length of a leaf centimeters or millimeters (cm; mm) are used
For the mass of a small stone, gram (g) are used.

Hope this helps! :)
3 0
3 years ago
Read 2 more answers
Other questions:
  • During the process of photosynthesis, energy from the sun is converted into?
    7·1 answer
  • In the DESERT BIOME, which of the following could be an example of mutualism?
    12·1 answer
  • What does a poison control center do?
    14·2 answers
  • What was the main result of the Persian Wars?
    13·1 answer
  • A subspecies is a different group within a species that is able to interbreed but is usually prevented from doing so by geograph
    7·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What process is responsible for creating magnetic changes along mid-ocean ridges
    11·1 answer
  • This paramecium has a nucleus and is comprised of one cell. Which terms best describe this organism?
    12·1 answer
  • What is gene expression​
    12·1 answer
  • When a hormone is present in excessive levels, the number of target-cell receptors may decrease. This is called:.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!