1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
3 years ago
14

PLEASE HELP!!!

Biology
1 answer:
OverLord2011 [107]3 years ago
8 0

Answer:

B. The response counteracts the original stimulus.

Maybe I dont know

You might be interested in
True or false: Most muscles contain a combination of all three muscle types, slow oxidative, fast oxidative, and fast glycolytic
kkurt [141]

Thanks to what we know about muscles and the fibers they contain, we can confirm that the statement in the question is in fact true.

Muscle is a type of tissue which due to coordinated systems that make up their composition, have the ability to contract. This ability allows for greater efficiency. In humans, the muscle systems are classified into three kinds:

  1. Cardiac muscle
  2. Skeletal muscle
  3. Smooth muscle

Despite the different classifications and functions of each muscle type, each of these muscles contains a combination of three types of muscle fibers, which are the fibers listed in the question:

  1. Slow oxidative
  2. Fast oxidative
  3. Fast glycolytic.

To learn more visit:

brainly.com/question/1462286?referrer=searchResults

3 0
3 years ago
Spinal traction with metal tongs in the skull is used to treat a fracture of the
adell [148]
The answer to this question would be: vertebrae 

In vertebrae fracture, traction is important to assure immobilization of the vertebrae. Movement can cause the fragment of bone in the fracture damaging the neural tissue in the vertebrae.
To ensure no movement in the neck, metal tongs can be put on the skull. The tongs will help fixate the skull with the shoulder.
4 0
3 years ago
01:
Rudik [331]

the evidence will be DNA

Hope it helps u dear :)

Explanation:

7 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
BEFORE equilibrium has been reached in this container: (Circle a letter for each) 1. Movement of glucose across the membrane in
qwelly [4]

Hello. You forgot to put the image so that this question can be answered, but I will describe what the image shows.

The image shows two types of "cups" that have a type of connection between the two. In cup A there is 1 mole of glucose and 1 mole of fructose. In cup B there is 0.1 mol of glucose and 1.5 mol of fructose.

Answer:

A. Solution A to Solution B

Explanation:

Balance is achieved when the "cup" with the lowest concentration of glucose receives glucose from the "cup" with the highest concentration, to the point that the two glasses establish equal concentrations of glucose between them.

We know that cup B has a lower concentration of glucose, which indicates that the movement of this solute was from cup A towards cup B. With this we can conclude that the letter A is the correct answer.

3 0
3 years ago
Other questions:
  • The theory of plate tectonics explains all of the following except A. continental movement. B. earthquakes. C. weathering. D. vo
    7·2 answers
  • Sperm cells have a very specialized structure, including a flagellum and very little cytoplasm. explain how the structure of a s
    14·1 answer
  • One eighth to one sixth of the adult number of alveoli are present in the lungs at birth. their number increases after birth for
    8·1 answer
  • Which of these organism would be a producer
    11·2 answers
  • How might knowledge of science be important to an artist?
    10·1 answer
  • Angelique has several symptoms of pneumonia that her doctor diagnoses as being caused by a virus. Her parents ask for an antibio
    5·2 answers
  • Which structures allow lycophytes to grow bigger than mosses and liverworts?
    14·1 answer
  • Please help with my biology
    8·2 answers
  • Rocky's class recently got pet turtles. When putting together the habitat, decomposers were added to
    12·2 answers
  • Biologically term for: The green, light - tripping pigment in photosynthesis foundin plants leaves​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!