1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksenya-84 [330]
3 years ago
14

What is the state of matter where all the arrows are being pointed

Biology
1 answer:
Bess [88]3 years ago
4 0
Spoon solid
vapor gas
bowl solid
soup liquid
You might be interested in
What is the central theme and how is that developed In “the story of an hour.”
bonufazy [111]
The Story of an Hour Theme of Freedom and Confinement. At first, freedom seems like a terrible thing to Mrs. Mallard, who's restricted in lots of ways: through her marriage, by her bad heart, and even inside her home, which she doesn't leave during "The Story of an Hour."
3 0
3 years ago
Cholera is a disease that is spread in water. Which treatment would most likely benefit society to prevent the spread of cholera
rewona [7]
The best way to prevent cholera is to promote healthy sanitation practices and to filter and treat drinking water sources.  Cholera bacterium is usually found in water or food sources that have been contaminated by feces from infected person with cholera. It is mostly found and spread in places with inadequate water treatment, poor sanitation, and inadequate hygiene.
7 0
3 years ago
Read 2 more answers
The first step in testing whether a population is in Hardy-Weinberg equilibrium is to calculate the allele frequencies in the po
Zepler [3.9K]

Answer:

Allele frequencies in the population is 0.6

Explanation:

The first step in testing whether a population is in Hardy-Weinberg equilibrium is the frequency of an allele in a gene pool is the number of copies of that allele divided by the total number of copies of all alleles at that locus.

8 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Which phrase best describes the main goal of a human community? O A. To meet needs through collective effort O B. To make and fo
valentina_108 [34]

Answer:

Hello There!!

Explanation:

I believe the answer is A. To meet needs through collective effort.

hope this helps,have a great day!!

~Pinky~

5 0
3 years ago
Other questions:
  • Which is RNA polymerase binding site on a typical gene?
    6·2 answers
  • Scenario #1
    7·1 answer
  • Which is the immediate result of stopping the glycolysis process?
    14·1 answer
  • In which type of climate does chemical weathering usually occur most rapidly?
    14·2 answers
  • How are electromagnetic waves similar to transverse waves​
    5·1 answer
  • If 60 seconds are in a minute, 60 minutes in an hour, and 24 hours in a day, then 86,400 seconds are in a day. What type of reas
    11·2 answers
  • Removes water from waste and puts it back into the body; waste turns into solid here. *<br>​
    8·1 answer
  • Need help asap please
    15·2 answers
  • He journey of a protein starts in the
    12·1 answer
  • how do the atoms in carbon dioxide and water are rearranged during photosynthesis to yield glucose and molecular oxygen.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!