1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
3 years ago
12

Which of these factors has the greatest influence on how many koala live in an area

Chemistry
1 answer:
Rom4ik [11]3 years ago
3 0

Answer:

G - the number of eucalyptus trees available

You might be interested in
How do seismologists, or scientists who study earthquakes, know that the largest known earthquake to hit the region occurred aro
denis23 [38]

Answer:

By looking at the amount of time between the P and S wave on a seismographs recorded on a seismograph, scientists can tell how far away the earthquake was from that location. However, they can't tell in what direction from the seismograph the earthquake was, only how far away it was.

Explanation:

5 0
3 years ago
Identify the reactants and the products in this chemical equation.<br><br> 2Fe2O3 + 3C → 4Fe + 3CO2
aivan3 [116]

Answer:

Fe₂O₃ and C are reactants

Fe and CO₂ are products

Explanation:

Reactants:

Chemical species that are present on left side of chemical reaction equation are called reactants.

Product:

Chemical species that are present on right side of chemical reaction equation are called product.

Chemical equation:

2Fe₂O₃ + 3C  →  4Fe + 3CO₂

In this reaction 2 mole of iron oxide is react with three moles of carbon and produced four moles of iron and three moles of carbon dioxide. There are equal numbers of atoms of all elements present on both side of chemical reaction so this reaction follow the law of conservation of mass.

Law of conservation of mass:

According to the law of conservation mass, mass can neither be created nor destroyed in a chemical equation.

Explanation:

This law was given by french chemist  Antoine Lavoisier in 1789. According to this law mass of reactant and mass of product must be equal, because masses are not created or destroyed in a chemical reaction.

7 0
3 years ago
Is 13.0 mv at 25 °c. calculate the concentration of the zn2 (aq) ion at the cathode?
Andrews [41]
Answer: 
 Zn =⇒ Zn+2(0.10) + 2e- (anode)
 Zn+2(?M) + 2e- === Zn(s) (cathode)
 
 Zn + Zn+2(?M) ===⇒ Zn+2(0.10) + Zn 
 E = E^o -0.0592 log Q; in this case E^o is zero. 
 E = - 0.0592 /n logQ where n is the number of electrons transferred, in this
case n = 2 
 23 mV x 1 volt/1000mv = 0.023 Volts 
 0.023 = -0.0592 / 2 log(0.10) / [Zn+2]
 0.023 = -0.0296 { log 0.10 – log [Zn+2] }
 0.023 = -0.0296{ -1 - log[Zn+2] }
 0.023 = +0.0296 + 0.0296log[Zn+2]
 -0.0066 = 0.0296log[Zn+2]
 -0.22= log[Zn+2]
 [Zn+2] = 10^-0.22 = 0.603 Molar

6 0
3 years ago
DNA transcription-to-translation # 1 Homework Unanswered Due in 4 days Given the following sequence of the coding strand, writte
uysha [10]

Explanation:

Translation is the process by which a polypeptide is polymerized from genetic information.

Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).

DNA:  5'-  CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'

mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'

mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.

In order to do this we need to look up the genetic code and assign the proper amino acids.

Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.

3 0
3 years ago
What liquid is the most vicious ?
Dmitry [639]
Viscosity is basically how thick a liquid is so pancake syrup would be the answer
6 0
3 years ago
Other questions:
  • People tend to speak more quietly in restaurants than they do when they are having an ordinary conversation Restaurant conversat
    15·1 answer
  • How do I do question C?! Mass to moles
    12·1 answer
  • X2SO3 Enter the group number of X. How do I find this? Chemistry
    12·2 answers
  • Draw the structure of 4-chlorophthalic acid in the window below.
    7·2 answers
  • 365g MnSiO3 = ___ mol
    8·1 answer
  • When sediment is eroded and then deposited at the mouth of a river, it can form a
    9·1 answer
  • 2. What properties do all acids have?
    10·1 answer
  • The heating curve shows the energy gain of a substance as it changes from solid to gas. Which section of graph shows the liquid
    8·1 answer
  • A teacher divides her class into four groups. She assigns
    15·1 answer
  • Select the answer for this number showing three significant figures. Remember to round if necessary. 0.566 m 0.600 m 0.570 m 0.5
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!