Answer:
By looking at the amount of time between the P and S wave on a seismographs recorded on a seismograph, scientists can tell how far away the earthquake was from that location. However, they can't tell in what direction from the seismograph the earthquake was, only how far away it was.
Explanation:
Answer:
Fe₂O₃ and C are reactants
Fe and CO₂ are products
Explanation:
Reactants:
Chemical species that are present on left side of chemical reaction equation are called reactants.
Product:
Chemical species that are present on right side of chemical reaction equation are called product.
Chemical equation:
2Fe₂O₃ + 3C → 4Fe + 3CO₂
In this reaction 2 mole of iron oxide is react with three moles of carbon and produced four moles of iron and three moles of carbon dioxide. There are equal numbers of atoms of all elements present on both side of chemical reaction so this reaction follow the law of conservation of mass.
Law of conservation of mass:
According to the law of conservation mass, mass can neither be created nor destroyed in a chemical equation.
Explanation:
This law was given by french chemist Antoine Lavoisier in 1789. According to this law mass of reactant and mass of product must be equal, because masses are not created or destroyed in a chemical reaction.
Answer:
Zn =⇒ Zn+2(0.10) + 2e- (anode)
Zn+2(?M) + 2e- === Zn(s) (cathode)
Zn + Zn+2(?M) ===⇒ Zn+2(0.10) + Zn
E = E^o -0.0592 log Q; in this case E^o is zero.
E = - 0.0592 /n logQ where n is the number of electrons transferred, in this
case n = 2
23 mV x 1 volt/1000mv = 0.023 Volts
0.023 = -0.0592 / 2 log(0.10) / [Zn+2]
0.023 = -0.0296 { log 0.10 – log [Zn+2] }
0.023 = -0.0296{ -1 - log[Zn+2] }
0.023 = +0.0296 + 0.0296log[Zn+2]
-0.0066 = 0.0296log[Zn+2]
-0.22= log[Zn+2]
[Zn+2] = 10^-0.22 = 0.603 Molar
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
Viscosity is basically how thick a liquid is so pancake syrup would be the answer
