1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tino4ka555 [31]
3 years ago
15

Gizmo: Rainfall and Bird Beak Evolution

Biology
1 answer:
solniwko [45]3 years ago
3 0
I believe the answer is spring
You might be interested in
What will happen when the sun runs out of hydrogen to convert to helium
PSYCHO15rus [73]
We will all be dead.
4 0
3 years ago
What happens when aerobic and anaerobic over lap
Eduardwww [97]
Sources during exercise based on the type of exercise performed, and therefore in most occasions the body will overlap between aerobic and anaerobic energy pathways. ... Conversely, lower levels of lactic acid means that the aerobic pathway predominated.
3 0
3 years ago
There is an enzyme that catalyzes the production of the pigment responsible for dark fur color in siamese cats and himalayan rab
MariettaO [177]

Answer:

Light brown colour will be appear.

Explanation:

If the rabbit raised at 20 c then the rabbit gain brown colour because the pigment which is responsible for the dark colour does not work due to increase in temperature. Enzymes are those substances which speedup the chemical reaction so when the temperature becomes higher, the enzyme did not function properly and the colour pigment gives light brown colour to the rabbit.

6 0
3 years ago
Humans and mice have similar genomes. In fact, researchers have found thousands of genes that exist in both mice
Svetach [21]

Answer:

mice and humans share virtually the same set of genes

Explanation:

Almost every gene found in one species so far has been found in a closely related form in the other. Of the approximately 4,000 genes that have been studied, less than 10 are found in one species but not in the other.

7 0
3 years ago
Read 2 more answers
The storage form of carbohydrates in animals is __________; and in plants, it is __________.
noname [10]
<span>Glycogen(for animals), Starch(for plants) </span>
7 0
3 years ago
Other questions:
  • I need help!!! Calculating pH, pOH, [H+] and [OH-]
    14·1 answer
  • Are clouds abiotic or biotic
    13·2 answers
  • Blue, brown, and green beetles from a forest migrated to a rocky mountain after a natural disaster. In the new environment, brow
    10·2 answers
  • L-Arabinose is a naturally occurring, non-caloric sweetener that is a non-competitive inhibitor of sucrase. If L-Arabinose is co
    7·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The most common place to find divergent boundaries is
    15·2 answers
  • Enzymes are examples of which type of macromolecule?
    11·2 answers
  • Why are there two copies of each chromosome? Question 5 options: One copy comes from each parent Chromosomes were duplicated in
    8·1 answer
  • What type of agriculture is most characteristic of a third-world developing country?
    7·2 answers
  • A. What are the two main types of seismic waves that are created during an
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!