1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valina [46]
2 years ago
7

Which best explains how the collisions of materials in space contribute to the formation of layers in protoplanets?

Biology
2 answers:
Sedbober [7]2 years ago
8 0

Answer:The best explanation is;

The materials undergo decay when they collide, which results in the heating and subsequent melting and rising of materials

Explanation: A protoplanet is an embryo formed in a protoplanetary disc which has passed through a melting phase that enables the formation layered interior

In protoplanets the effects of partial melting of the components due to heating produced by radioactive decay and  pressures from forces of gravity there is segregation of the melt and igneous composition such that the heavier melted metal can sink and be over laid by the lighter igneous rocks

Therefore, the best explanation is that the materials undergo decay when they collide, which results in the heating and subsequent melting and segregation by the sinking of the heavier melted materials and rising of the lighter igneous materials.

zimovet [89]2 years ago
4 0

Answer:

A

Explanation:

I took the text

You might be interested in
Which movement of particles would be most affected by a disorder that causes damage to carrier proteins ?
Makovka662 [10]

Active transport;

The movement of particles would be most affected by a disorder that causes damage to carrier proteins is the active transport.

Explanation;

Active transport involves the movement of materials against the concentration gradient.

This type of transport requires energy in form of ATP to aid the movement of particles from a lower concentration to a higher concentration.

Active transport requires carrier proteins such as the sodium-Potassium pump, to move materials in and out of the cell.

7 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
How was the clean air act of 1970 different from previous legislation aimed at reducing pollution?
Ede4ka [16]

Answer: B

Explanation:

I just did it

8 0
3 years ago
What is a primary reason an increase in glaciers on land would cause sea level to fall? g?
LiRa [457]
The amount of water on the planet is fixed; it neither increases or decreases. Glaciers are sheets of moving ice. This water to form these extensive sheets must come from somewhere. The water comes from the most extensive store on the planet; the oceans. Ice Ages always corresponds to periods of low sea level because much of the ocean water is is land locked as glaciers. 
4 0
3 years ago
Flying foxes are actually tree-dwelling bats.true or false​
ZanzabumX [31]

Answer:

TRUE!

Explanation:

Little red flying foxes are tree-dwelling bats. In daytime they can be seen roosting in giant camps that may include as many as a million individuals. The bats are indeed efficient fliers, as their name suggests, but time in the trees has also made them excellent climbers.

3 0
3 years ago
Other questions:
  • Like animals, plants undergo cellular respiration to produce energy. Plants use oxygen and release carbon dioxide and water. Wat
    6·2 answers
  • There are two color morphs of male panther chameleons, blue and orange. Blue chameleons live in trees with blue flowers and frui
    10·1 answer
  • Pada proses spermatogenesis, sperma-toska memerlukan nutrisi yang diperlukan dari
    13·1 answer
  • If the sequence of bases in one strand of dna is tagcct, then the sequence of bases in the other strand will be
    14·2 answers
  • Describe how meiosis and mitosis are similar and different. Provide at least two similarities and 3 differences.
    9·1 answer
  • The circle graph below represents 500 people, how many more people prefer to watch football than soccer?
    13·1 answer
  • What actions can you take to reduce water pollution?
    9·2 answers
  • Advantages of water for renewable resource​
    15·1 answer
  • A particular triplet of bases in the coding strand of DNA is 5'-CGT-3: Which of
    9·1 answer
  • Sort...
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!