1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alja [10]
3 years ago
13

8. The honeycomb-like appearance of this sandstone is a result of

Biology
2 answers:
musickatia [10]3 years ago
7 0
The answer Is B have a good day.
Solnce55 [7]3 years ago
4 0
I think that it is B hope that is right :))
You might be interested in
Identify the choice that best completes the statement or answers the
mixer [17]
Evaporation of the liquid
4 0
3 years ago
How does energy drive the cycling of matter through different geological processes?<br><br>​
Evgesh-ka [11]

Answer:

Here is the link to answer

Explanation:

bit. ly/3a8Nt8n

3 0
3 years ago
What are convections of the atmosphere and the oceans due to?
Yuri [45]

Answer:

The convention has resolved several important issues related to ocean usage

6 0
3 years ago
Read 2 more answers
A town’s population size has been slowly increasing for the past five years. The town’s total electricity use has also slowly in
natta225 [31]
The reason why the electricity could decrease is because the population of the town’s people has gone down causing the electricity rate to decrease. Hope this helps you.
6 0
2 years ago
In fish or flaxseed the best source of omega3 fatty acids? Why?
Katena32 [7]
Fish because it is full of healthy oils. But depends on the kind of fish. I know salmon is rich in omega 3 fa
3 0
3 years ago
Other questions:
  • What is responsible for setting up the differences between the tropical, temperature, and polar zones?
    10·2 answers
  • Which uses water to remove smoke from burning coal
    5·2 answers
  • Which stage of cellular respiration requires oxygen that you breathe?
    7·2 answers
  • Each summer in MA illnesses caused by the vibrio parahaemolyticus trigger mandatory a 14-day federally mandated ban on the barve
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • List the four classes of biological macromolecules. Then describe the basic structural components of each macromolecule class an
    9·1 answer
  • What is TRUE about the relationship between cells and the organism that they are a part of?
    13·2 answers
  • Clear selection
    10·1 answer
  • Which is NOT one of the three main categories of adaptations?
    12·1 answer
  • Albino individuals lack all pigmentation so that their hair and skin are white. This pedigree shows that albinism -
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!