1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldfiish [28.3K]
3 years ago
10

A scientist observes that a certain trait is determined by a single gene.

Biology
1 answer:
tangare [24]3 years ago
7 0

Answer:

Codominance

Explanation:

Codominance occurs when both alleles participation in the expression of the genotype of an offspring, such as a flower with patches of different colours, each coming from a different allele.

You might be interested in
ntroduction: The 19th century was the time of the Industrial Revolution in England. Most of the new industries used coal for ene
Rasek [7]

Answer:

Light colored peppered moths decreases in number and dark colored peppered moths increases.

Explanation:

The population of light colored peppered moths decreases whereas the dark colored peppered moths increases in number because the light colored peppered moths are visible to the predator birds  whereas the dark colored peppered moths are not visible due to dark coating of the trees so they are saved from the birds and therefore, increase in population of dark colored peppered moths occurs and decrease occur in light colored peppered moths population.

5 0
3 years ago
What would happen to skin cells if mitosis did not take place
lina2011 [118]

Answer:

Skin cells would die and not be replaced.

Explanation:

7 0
3 years ago
I am having trouble writing an itroduction to my lab report. For the lab we had to find an effective way to purify water. Any id
VLD [36.1K]
I HOPE THIS HELPS:

Many people don’t know how to get an effective way purify water but when you (tell them how to purify water) you will get an effective way to purify water. Stay tuned for all the details of how to purify water an effective way.

Can I get BRAINLIEST???
6 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
what is the defining characteristic of eukaryotic cells? what types of organisms have eukaryotic cells?
solniwko [45]

Answer: What is the defining characteristic of eukaryotic cells? Put these in your own words.

Eukaryotic cells are defined by the presence of a nucleus containing the DNA genome and bound by a nuclear membrane (or nuclear envelope) composed of two lipid bilayers that regulate transport of materials into and out of the nucleus through nuclear pores.

What types of organisms have eukaryotic cells?

There is a wide range of eukaryotic organisms, including all animals, plants, fungi, and protists, as well as most algae. Eukaryotes may be either single-celled or multicellular.

4 0
3 years ago
Other questions:
  • Which best describes the bond shown
    9·2 answers
  • Environments are covered with manmade structures like roads, buildings, and sewers. Green spaces such as parks, backyards, and u
    9·2 answers
  • When reproduction involves two parents, which TWO statements describe the offspring?
    8·1 answer
  • Which of the following is part of a clade believed to have died out, leaving no descendants?
    8·1 answer
  • Volcanic eruptions can cause _____.
    11·2 answers
  • Is 0.3 concentration high or low and why?
    6·1 answer
  • Please help me with 4 through 6
    7·1 answer
  • What is/are the function(s) of the cell cycle?
    14·1 answer
  • Lillian can't remember the names of her children. She is having difficulty speaking, reading, and writing. Lillian most likely s
    10·1 answer
  • Plzzzzz help me this is a test i have to do
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!