1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AveGali [126]
2 years ago
15

Which particle diagram represents a mixture? ( i hope you can read it)

Chemistry
1 answer:
Masja [62]2 years ago
8 0
The 3rd diagram is a mixture because it has 2 substances
You might be interested in
How important is it for scientists and engineers to be able to control the design of
Hatshy [7]

It is important for scientists and engineers to be able to control the design of the material because<u> it create solutions to problems</u>.

<h3>Why material science and engineering is important?</h3>

What things are made of and why they behave the way they do are lessons we learn from materials science. Materials engineering teaches us how to use knowledge to improve things and the way they are made. Research and industry innovation in fields as diverse as aerospace and medicine are driven by materials science and engineering.

<h3>Why is it important for scientists to use the scientific method?</h3>

The scientific method is essential because: It follows a set of rules. Scientists conduct experiments in a standardized manner because the steps used in the scientific method are systematic. This suggests that their research might be spread widely.

To know more about aerospace :

brainly.com/question/27182063

#SPJ9

4 0
9 months ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Which wave is used to identify the heat given off by distant objects in space
kicyunya [14]
Sorry if i’m late but your answer should be infrared
6 0
3 years ago
How does adding a non-volatile solute to a pure solvent affect the boiling point of the pure solvent?
belka [17]
The correct answer is the second statement. The solvent will have a higher boiling point. Adding a non-volatile solute to a pure solvent will increase the boiling point of the solvent. This solution exhibit colligative properties. Colligative properties depend on the amount of solute dissolved in a solvent. These set of properties do not depend on the type of species present. 
7 0
3 years ago
1. What does the Law of conservation of mass state?
kakasveta [241]

Answer:

According to the law of conservation of mass, the mass of the products in a chemical reaction must equal the mass of the reactants. The law of conservation of mass is useful for a number of calculations and can be used to solve for unknown masses, such the amount of gas consumed or produced during a reaction.

4 0
3 years ago
Other questions:
  • I neeeeeeeeeeeddddddddd help!!!
    10·2 answers
  • What are the electrons for calcium
    15·1 answer
  • A 100. ml portion of 0.250 m calcium nitrate solution is mixed with 400. ml of 0.100 m nitric acid solution. what is the final c
    14·1 answer
  • Perform the following calculations and express the answer with the proper significant
    6·2 answers
  • How many grams are 3.01 × 1023 molecules of CuSO4?
    8·1 answer
  • What volume of water must be added to 10.5 mL of a pH 2.0 solution of HNO3 in order to change the pH to 4.0 g
    15·1 answer
  • How does the structure of the steroid EXPLAIN the function of the steroid?
    7·1 answer
  • In which layer of the atmosphere can you find meteors?
    6·1 answer
  • How many electrons does gallium give up when it becomes an ion?
    10·1 answer
  • The Thermite reaction reacts iron (III) oxide, Fe2O3 with aluminium powder, Al, to form aluminium oxide, Al2O3 and iron, Fe. Fe2
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!