1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juli2301 [7.4K]
3 years ago
8

How do erosion and deposition shape the earth’s surface? I will mark 1st person to answer brainliest and you get 86 points!!!

Biology
1 answer:
Tanzania [10]3 years ago
5 0

Answer:

The material moved by erosion is sediment. Deposition occurs when the agents (wind or water) of erosion lay down sediment. Deposition changes the shape of the land. ... Water's movements (both on land and underground) cause weathering and erosion, which change the land's surface features and create underground formations.

You might be interested in
what are the advantages and disadvantages of using models to understand human impacts on earth's systems and the carbon cycle?
vredina [299]

Answer:

Models are used for understanding a process or phenomenon.

Explanation:

Advantages of using models:

1) It gives some information about the human impacts on earth's systems and carbon cycle.

2) It also helps in discovering the defects and errors.

Disadvantages of using models:

1) It did not fully explain the human impact on both earth and carbon cycle.

2) It is the simplified version not an actual version of the real situation of carbon cycle.

7 0
3 years ago
The proper treatment of experimental subjects helps to ensure which of the following? A.A hypothesis that no one can disprove B.
yulyashka [42]
It really is between C.or D. I say it is D. because you need the <span>experimental subjects in the best condition possible to get the best results.</span>
7 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Why are endocytosis and exocytosis important processes to cells?
irina [24]

Answer:

Endocytosis enables the cell to take in the bacteriaor fluid droplets from out side the cell and this is important for defense and nutrition respectively. Exocytosis is important for the cell to secrete products like hormones or enzymes to the outside so other body parts can make use of them like insulin and digestive enzymes from the pancreas.

3 0
3 years ago
Read 2 more answers
Features of a living thing,are called
marishachu [46]
All living things are composed of cells. Some organisms, such as algae, are composed of a single cell (called unicellular organisms), while others, such as animals, are composed of many (called multicellular organisms). All living things grow and develop. ... Lastly, living organisms respond to their environment.
6 0
3 years ago
Other questions:
  • How does weathering and erosion effect Earths surface?
    8·1 answer
  • Which statements are true about a stable community?
    14·2 answers
  • A parent with type ab blood could not produce a child with type
    11·1 answer
  • The excretory system is responsible for removing all of the following from the body except
    13·1 answer
  • This is a picture of cattle rearing. What do you want to know?
    11·1 answer
  • What is the complementary base to cytosine in DNA?
    10·1 answer
  • HELP PLEASE!!
    6·2 answers
  • In which direction does the Sun appear to move across the sky?
    5·2 answers
  • Skeleton in mammals
    10·2 answers
  • Which of the following phylogenetic trees best represents this data?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!