1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
OleMash [197]
3 years ago
13

Chloroplasts are unable to survive without the energy they receive from cell respiration. What conclusion can be drawn from this

fact?
It is not possible that chloroplasts ever existed as free-living bacterial cell and endosymbiotic theory is flawed.
As chloroplasts evolved, they transferred genes necessary for surviving on their own to their host cells.
Chloroplasts, unlike mitochondria, evolved from a species of bacteria that relied on anaerobic respiration for energy.
As chloroplasts evolved to convert light energy within a host cell, their own energy requirements increased to an unsustainable level.
Biology
2 answers:
RideAnS [48]3 years ago
8 0

Answer:

b

Explanation:

alexgriva [62]3 years ago
4 0
B: <span>As chloroplasts evolved, they transferred genes necessary for surviving on their own to their host cells.</span>
You might be interested in
Which of these factors could cause natural selection to occur?
Mice21 [21]
C. The presence of predators could cause natural selection because it would mean survival of the fittest. 
4 0
3 years ago
Read 2 more answers
3. Which of the following electromagnetic waves has the least energy on the
forsale [732]
Radio waves has the least energy
4 0
3 years ago
Consider how Photosynthesis and Cellular Respiration are linked. Explain how, together, the 2 processes can be described as a cy
miv72 [106K]
The products and reactants of each cycle are connected. reactants of photosynthesis (6O2 and C6H12O6) are recycled as products in cellular respiration which produces 6H2O 6CO2 and energy to fuel photosynthesis
7 0
3 years ago
What is one way to separate a substance that is dissolved in water?
Illusion [34]

Answer:

Mixtures can be separated using a variety of techniques. Chromatography involves solvent separation on a solid medium. ... Evaporation removes a liquid from a solution to leave a solid material. Filtration separates solids of different sizes.

7 0
3 years ago
Read 2 more answers
The last question! This is extremely hard!
MrRissso [65]
A marine layer is an air mass which develops over the surface of a large body of water such as the ocean or large lake in the presence of a temperature inversion. ... As it cools, the surface air becomes denser than the warmer air above it, and thus becomes trapped below it.
4 0
3 years ago
Other questions:
  • Porth's the composition of the cerebrospinal fluid is similar to extracellular fluid with the exception of
    5·1 answer
  • The graph shows the amount of pollution removed by trees during October, the Trees were able to remove the greatest about of___.
    13·1 answer
  • Why might it be beneficial to regulate what species of plats and animals people are allowed to own in particular environments ?
    9·2 answers
  • Is plastic biotic or abiotic?
    14·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which types of decisions are more prevalent at lower organizational levels? Group of answer choices Structured decisions Procedu
    15·1 answer
  • Plz help due in 9 min plZ will mark brainlest plz plzzzzzz plz
    11·1 answer
  • What would happen to a cell if there was no endoplasmic reticulum? Please help ;-;
    14·1 answer
  • During primary succession, an ecosystem cannot 're-build' with large trees and bushes. Explain.
    12·1 answer
  • In a genotype, what does the lower case letter represent?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!