1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marianna [84]
3 years ago
9

Identify the lobe that is associate with the following functions: 2 Auditory and memory. Movement and balance 5 Reasoning and pl

anning Visual processing : Occipital Lobe :: Parietal lobe - Temporal Lobe #1 Frontal obe​
Biology
1 answer:
brilliants [131]3 years ago
7 0

Answer:

sorry I don't know

Explanation:

in William Carlos Williams' poem "The Widow's Lament in Springtime," why does the poem take place in spring? A to contrast spring with grief B to contrast spring with insanity C to contrast spring with winter can you help me

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
if the substrate in the first image in the left of the diagram is a disaccharide (double sugar) such as sucrose,what is the enzy
otez555 [7]

The enzyme is a catalyst, meaning it is speeding up the chemical process.

4 0
3 years ago
What is a stem cell?
expeople1 [14]
An undifferentiated cell of a multicellular organism which is capable of giving rise to indefinitely more cells of the same type, and from which certain other kinds of cell arise by differentiation.
8 0
3 years ago
Read 2 more answers
If we were to compare the muscle cells of the puma to the epithelial cells, the muscle cells would contain relatively more A) ri
Grace [21]
D ribosomes because it makes the energy for the cells
3 0
3 years ago
Read 2 more answers
Which scenarios are examples of physical changes? Check all that apply
egoroff_w [7]
Chewing bread, tearing paper, breaking rocks
3 0
3 years ago
Read 2 more answers
Other questions:
  • The phenotype of an organism
    9·1 answer
  • Billy stepped on a beehive and got stung all over; now when he hears buzzing sounds, his blood pressure increases and he sweats.
    12·1 answer
  • Elements are pure substance consisting of only one type of atom and are catergorized on the periodic table element. For each of
    7·1 answer
  • What are the two most important driving forces of metamorphism?
    15·1 answer
  • Do the shortest duration of insolation and the minimum temperature occur in the same month?
    10·1 answer
  • A student set up an experiment to show the effect of light color on photosynthesis in Elodea plants. She filled three test tubes
    8·1 answer
  • What is the difference between commensalism and mutualism?
    15·2 answers
  • Ý nghĩa chủ yếu của việc phát triển các vùng chuyên canh cây công nghiệp lâu năm ở Tây Nguyên là
    10·1 answer
  • 2. How is primary succession different from secondary
    6·1 answer
  • Because the marshmallow burned for a short time in the marshmallow vs cheeto lab, it is safe to say
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!