1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lapatulllka [165]
3 years ago
8

The nervous system may be compared to a "

Biology
2 answers:
NARA [144]3 years ago
6 0

Answer:

A. A computer

Explanation:

The way your nervous system works can be compared to how your computer works. When you press the power on your computer, a signal goes out. The signal is a catalyst that generates a number of actions and responses. An electric current travels over the wires maintaining a connection to electricity

svlad2 [7]3 years ago
4 0
It wii oh hold be like a computer because it controls everything in ur body
You might be interested in
Help with these two questions, porfavor! :'/
Aliun [14]

The number of chromosomes does not correlate with the apparent complexity of an animal or a plant:

in humans, for example, the diploid number is 2n = 46 (that is, 23 pairs), compared with 2n = 78, or 39 pairs, in the dog and 2n = 36 (18) in the common earthworm.

4 0
3 years ago
Read 2 more answers
When did most marine life go extinct?
irinina [24]
252 Ma<span> (million years) 
Please give brainliest

</span>
8 0
3 years ago
How many types of atoms make up the structure of a single element
Nataliya [291]
There are two atoms that make up a single element
8 0
3 years ago
Read 2 more answers
Which answer is not a mechanism for evolution1.Mutations 2.Natural Selections3.Genetic Drift 4.Gene Pool?
Elden [556K]
4. Gene Pool is not a mechanism, thus your answer!
6 0
3 years ago
What living thing is homeostasis responsible for
Juliette [100K]

Answer:

Homeostasis is the ability to maintain a relatively stable internal state that persists despite changes in the world outside. All living organisms, from plants to puppies to people, must regulate their internal environment to process energy and ultimately survive.

3 0
2 years ago
Other questions:
  • Heterozygote advantage should be most closely linked to which of the following?
    13·1 answer
  • What is the best way to help you ensure continued success in both fitness and life?
    13·2 answers
  • What are the tectonic features and actions that result in seismic waves
    5·1 answer
  • What are two levels of organization found in living things?
    8·1 answer
  • The entire complex that forms to initiate DNA replication is known as:_______
    9·1 answer
  • The oak tree pathogen Phytophthora ramorum migrated 650 km in ten years. West Nile virus spread from New York to 46 others state
    14·1 answer
  • Describe what happens during cytokinesis in animal cells.
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Ae khuda tu bol de tere badlon ko
    13·2 answers
  • You are microscopic and stranded inside the right atrium during passive ventricular filling. How many potential escape routes do
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!