The molarity of the solution will be 0.72 m.
The majority of reactions take place in solutions, making it crucial to comprehend how the substance's concentration is expressed in a solution when it is present. The number of chemicals in a solution can be stated in a variety of ways, including.
The symbol for it is M, and it serves as one of the most often used concentration units. Its definition states how many moles of solute there are in a liter of solution.
Given data:
Molarity can be determined by the formula:
where, M is molarity and V is volume.
Put the value of given data in above equation.
57.3 × 0.497 m = M × 39.5 L
M = 0.72 m
Therefore, the molarity of the solution will be 0.72 m
To know more about molarity
brainly.com/question/18648803
#SPJ4
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
In a chemical reaction, the difference between the potential energy of the products and the potential energy of the reactants is equal to the heat of the reaction<span>. This is, the net energy released or absorbed (change) during a chemical reaction is the sum of the potential energy of the products less the sum of the potential energy of the reactants.</span>
Answer:
Explanation:
Hello there!
In this case, since the equation for the calculation of dilutions is:
Whereas M is the molarity and V the volume, because the final concentration is lower than the initial. Thus, since we are asked to calculate the final volume, we solve for V2 as follows:
Best regards!
