1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilia_Sergeevich [38]
3 years ago
15

What is silica used for?

Biology
1 answer:
tankabanditka [31]3 years ago
3 0
Vast away of industries, like the other person said they said more
You might be interested in
What is source of the DNA for the strawberry plant?
SashulF [63]

Answer:

passed on by parent plant

Explanation:

both parents dna are present half of fathers and half of mothers

3 0
4 years ago
Read 2 more answers
Can biodiversity of a natural grassland be increased by introducing cattle. (which were not originally present). Give reason​
Gelneren [198K]

Explanation:

Biodiversity means the diversity in different species which are dependent for nutrient involved in nutrient chain.by introducing many more cattle is not a diversity it will be a same species and it will only increase Biomass

5 0
3 years ago
How and why does a comet change as it approaches the sun?
Archy [21]
It melts into a tail and vanishes
3 0
3 years ago
98 POINTS 98 POINTS<br><br> PLS HELP MEEEE
blsea [12.9K]
I know them in Spanish 
Esta formado por los 206 huesos repartidos por casi todas las partes del cuerpo.  Que permiten el aparato locomotor  Que pueden ser largos, cortos, planos  Que forman el esqueleto y proteccion para los organos internos  Que se unen en tejido oseo, y tejido cartilaginoso  Que son la columna vertebral, craneo, y pelvis
7 0
4 years ago
Read 2 more answers
White eyes are recessive in flies. can two red eyed flies have white eyed offspring
MissTica

Answer:

Considering that white eyes are a recessive trait in flies, it is possible for two red-eyed flies to have offspring with white eyes only if both are heterozygous for this trait.

Explanation:

For two individuals with dominant phenotype for a trait to have offspring with the recessive trait, both must have a heterozygous genotype.

In the case of the characteristic eye color of the flies :

  • <em>Red eye (R) is dominant trait. </em>
  • <em>White eyes (r) is the recessive trait. </em>

When both parents are heterozygous, their genotype is Rr

In Punnett Square it can see the result of the crossing of these individuals:

Punnett Square :

<em><u>Rr X Rr </u></em>

<em>Alleles     R     r </em>

<em>R              RR   Rr</em>

<em>r               Rr    rr</em>

In the offspring, the probabilities are:

  • 50% heterozygous individuals Rr, with red eye phenotype.
  • 25% pure dominant individuals RR, with red eyes
  • 25% individuals with the recessive rr genotype, white eyes.

<u>This is the possibility of two red-eyed flies having white-eyed offspring</u>.

6 0
3 years ago
Other questions:
  • What is the process in which forest plants release water back into the atmosphere?
    10·2 answers
  • What are reactants!!!!!!!!!!!!!!!!!!!!!!!!!
    5·1 answer
  • Mechanoreceptors that react to changes in pressure are part of the _____
    12·2 answers
  • Plants reproduce though
    7·2 answers
  • WILL MARK BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!
    7·2 answers
  • Lipids consist of ________, ________ and ______.
    5·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • The human circulatory system is a double circulatory system.
    13·1 answer
  • Please help!!! Happy holidays
    10·1 answer
  • Why is pumpkin a incomplete flower?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!