1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kodGreya [7K]
3 years ago
13

Positive feedback increases, intensifies, or speeds up a process in the body. True or false

Biology
2 answers:
lubasha [3.4K]3 years ago
8 0

Answer:

The answer is True

BlackZzzverrR [31]3 years ago
7 0

Answer:

True

Explanation:

Positive feedback is anything that increases or adds to something. Negative feedback is anything that decreases or takes away from something.

You might be interested in
1. Fresh lava traps the direction of the earth's magnetic pole as it hardens.
melomori [17]
<span>1. As lava cools, it begins to go in the magnetic direction of the pole. It actually has been able to show magnetic pole changes throughout history this way. 2. The youngest rocks, crust, and fossils are near the ridge. 3. True, and this is essential for the theory of plate tectonics to work.</span>
6 0
3 years ago
What will be produced if wine is aerated and inoculated with bacteria of the genera acetobacter and gluconobacter?
givi [52]
I think Acetic acid will be produced if wine is aerated and inoculated with bacteria of the genera acetobacter and gluconobacter. Acetobacter is a genus of acetic acid bacteria. This bacteria is used for the mass production of Acetic Acid, the main component in vinegar. Gluconobacter is also a genus of the acetic acid bacteria family. 
3 0
4 years ago
Groundwater _____. A)exists above the earth's surface B)is impossible to pollute C)forms when precipitation seeps into the soil
kirill [66]

Answer: C

Explanation: It isn't impossible to pollute and it is a usable water source AKA wells

8 0
3 years ago
Read 2 more answers
Please help me with this question!
pickupchik [31]

1) a decrease in the amount of groundwater.

3 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • A mutant version of mouse-ear cress (Arabidopsis thaliana) has been engineered to convert it from a long-day plant to a short-da
    13·1 answer
  • Wich bread molds the fastest rye or white bread?
    8·1 answer
  • Atoms that vary in the number of neutrons found in their nuclei are called _______.
    13·1 answer
  • ****PLEASE HELP****There are green and red bugs living in an area. As a result of an environmental change, birds that live in th
    9·2 answers
  • A preschooler's mother was exposed to cats during her pregnancy, and the child has toxoplasmosis. which influence on development
    10·1 answer
  • Explain how traits that are not expressed in one generation can reappear in the next generation
    10·1 answer
  • Which of the following substances dissolve to a significant extent in water?
    13·1 answer
  • Why is a cap added to mRNA, but not to tRNA or rRNA? Transfer RNA and rRNA exhibit complex structures with double stranded regio
    7·1 answer
  • Gold is ...
    13·2 answers
  • Which of the following statements about aquatic ecosystems IS correct?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!