1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
storchak [24]
3 years ago
5

Select the correct answer.

Biology
2 answers:
andrew-mc [135]3 years ago
7 0

Answer:

precipitation is when it rains. it occurs last

Explanation:

patriot [66]3 years ago
4 0

Answer:

its C

Explanation:

You might be interested in
Which of the following statements about the sympathetic nervous system is true? A. Stimulation of the sympathetic nervous system
geniusboy [140]

Answer:

D. The nerves exit the central nervous system in the head and from the lumbar spine.

Explanation:

The preganglionic neurons transmit the nerve impulses through the cranial or spinal nerves that arise from the brain, to the postganglionic neurons from where the nerve fibers that relay these nerve signals to the different viscera and effector organs, located along the spinal cord

6 0
3 years ago
The red pigment in erythrocytes is _____, which transports oxygen
Aleksandr [31]

Explanation:

hemoglobin is that pigment which is present in erythrocytes and transports oxygen.

3 0
3 years ago
Choose the statement that correctly identifies the process and location that produces most ATP from ADP during cellular respirat
bearhunter [10]

Answer:

electron transport in mitochondria

Explanation:

6 0
3 years ago
Read 2 more answers
How does the way that matter cycles through an ecosystem differ from the way energy flows?
Tomtit [17]

Answer:

Unlike the one-way flow of energy, matter is recycled within and between ecosystems.

Explanation:

6 0
4 years ago
Read 2 more answers
A man with type O blood and a woman with type AB blood get married. What is the probability that they will have a child with typ
Arte-miy333 [17]

Answer:

b

Explanation:

3 0
3 years ago
Other questions:
  • The mass number of iodine is 126, and it’s in the 53rd place in the periodic table. It has ___ protons and ___ neutrons
    9·2 answers
  • True or false The tides have the greatest effect on marine plants and animals in estuaries and along
    15·1 answer
  • An isolated colony on a streak plate contains millions (or even billions) of identical cells all arising from one initial cell.
    15·1 answer
  • Could someone please answer this? Have you ever felt rain or snow falling down on you? Why do you think liquid water tends to mo
    11·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which major processes were needed for the origin of life on Earth?
    12·1 answer
  • How does genetics work in humans?
    9·1 answer
  • What does a cell use to repair its tissues or for growth
    6·2 answers
  • Explain what beak will thrive the most in survival and reproduction. Why?
    6·1 answer
  • A sunny and windy city near a mountain river currently uses 40% coal, 30% natural gas, 25% hydroelectric, and 5% other renewable
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!