1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nignag [31]
3 years ago
12

1) List three properties of rocks.​

Biology
2 answers:
denis23 [38]3 years ago
8 0

Answer:

three properties of rocks are;

  • they are hard
  • they have shape and size
  • they have different texture.
Oliga [24]3 years ago
7 0

Answer:

Their shapes vary

They are hard

They have different textures

Explanation:

Hope it helps

Have a great day :)

You might be interested in
I NEED HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
blsea [12.9K]

Answer:

I believe Mac should increase the tilt.

Explanation:

6 0
3 years ago
Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.
seraphim [82]

The infected papaya trees will produce less carbohydrates or chemical energy for the toucan. If there were fewer carbohydrates within each papaya, the toucan's muscle cells would not be able to obtain as much chemical energy as they normally do. This chemical energy will be converted into mechanical energy or heat flow, which the toucan uses to fly.

Therefore, the lower amount of mechanical energy and heat flow from the muscle contractions, it would result into a reduced amount of kinetic energy of motion when the toucan is flying.

3 0
3 years ago
Read 2 more answers
____________ livestock are produced with extra copies of growth hormone genes to allow them to grow faster and produce meat that
sergey [27]

Answer:

Transgenic

Explanation:

I did the the usa test prep

7 0
3 years ago
What do the arrows in a food chain represent?
Molodets [167]
C) how energy moves from organism to organism
8 0
3 years ago
Read 2 more answers
Nerve damage leading to neurological impairment is a function of chronic exposure to inhalant drugs. how might inhalants affect
Ray Of Light [21]
Inhalant drugs usually affect the neurons by damaging the myelin or myelinolysis. In the event of myelin damage, the saltatory conduction of the nerve will be deranged and the conduction velocity will be reduced, even in large diameter nerves. This can lead to significant neurological impairments to the patient.
3 0
4 years ago
Other questions:
  • In mammals, mature red blood cells do not have mitochondria. Instead of using oxygen to help produce ATP, they use a form of ana
    13·1 answer
  • All cells have the same genetic information, but do not express the same genes. How is this possible?
    7·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • If a field population started with 50% standard (YY) plants and 50% yellow-green (yy) plants, how would you expect the frequenci
    9·1 answer
  • What is not a part of mitosis?
    11·1 answer
  • Punnett squares are used to show possible combinations of alleles or to predict the probability of a trait occurring in offsprin
    15·2 answers
  • Researchers today can use technology such as fMRI scans to measure brain activity. Some researchers ask their subjects to descri
    6·1 answer
  • In peas, the round allele is dominant over the wrinkled allele. If a plant with round peas is crossed to a plant with wrinkled p
    6·1 answer
  • Describe the difference between a gene and an allele?
    8·1 answer
  • Features are inherited characteristics or structures. <br> True or False
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!