1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hammer [34]
3 years ago
10

The wall of the eye has three layers. The outermost fibrous layer is made up of the opaque white sclera and the transparent ____

______.A. ciliary glandB. choroidC. corneaD. lacrima
Biology
2 answers:
Natasha_Volkova [10]3 years ago
7 0

Answer:

C. cornea

Explanation:

jasenka [17]3 years ago
5 0
Answer c cornea
i think
You might be interested in
Suppose that a woman had to have part of her thyroid gland surgically removed. She would most likely suffer from a condition kno
Assoli18 [71]

Answer:

4. Thyroid hormone levels decrease, TRH level increase, PRL level increase

Explanation:

Surgical removal of Thyroid gland will lead to hypothyroidism.

Normally, the surgery is followed by maintenance dose of thyroxine to avoid side effects.

In the presence of hypothyroidism, however, the decreased thyroid hormone will lead to increase in thyrotropin releasing hormone (TRH). increased TRH increases production of prolactin. (but less than that in prolactinoma)

6 0
3 years ago
Read 2 more answers
Intermediate photographs should show the relation of evidence to other parts of the crime scene. A. True B. False​
hichkok12 [17]

Answer:

True.

Explanation:

<em>"adjective </em>

<em>adjective: intermediate </em>

<em>coming between two things in time, place, order, character, etc."</em>

Pictures correlating to the crime scene are like puzzles to find out the other meanings or cause of another picture.

For example:

A opened jug of milk sits on a table.

There's a blurred figure of a hand hitting the jug.

The jug is now laying on the table, dripping everywhere.

-

If we take out the middle picture "There's a blurred figure of a hand hitting the jug.", then we would not know what hit it over. Did someone bump into the table? Did a cat climb onto the table and release its almighty strength onto it? All we would know that it was once standing upright.

TLDR; Without intermediate pictures, it would be hard to grasp what happened on the scene. Intermediate pictures all have something in common with each other to help interpret what occurred to the viewer.

5 0
4 years ago
What are three possible problems that could have caused farley's symptoms?
anastassius [24]
 Anaphylaxis,<span>serum sickness and toxicity from food are the three problems.
Anaphylaxis refers to a severe and very serious allergic reaction which should be treated right away otherwise it may caus death, Serum sickness is also similar to the allergy and in type II hypersensitivity and clinically we can say that the reaction due to the medicine that does not contain protein. Toxicity from food refers to the food poisoning that is caused by contaminated food.</span>
7 0
3 years ago
What molecule provides immediate energy
bagirrra123 [75]
Idk sorry lol lol lol lol
3 0
3 years ago
A man has blood type O, Rh negative. These are both recessive traits. He is married to a woman who has blood type A, Rh positive
frosja888 [35]

IAIARr is the genotype of the mother.

<h3><u>Explanation</u>:</h3>

The blood groups are the heredity characteristics of the individual which governs what antigen will be present in blood and what antibody will be present in the blood plasma.

The blood group has the genetic characteristics where A and B are dominant characters and O is the recessive character. Co Dominance is seen in case of blood grouping. Similar characteristics is seen with Rh character too where Rh positive is the dominant character and Rh negative is recessive.

The father has both the recessive characteristics. So he needs to be genetically homozygous which means that he has genetic setup of IoIo and rr.

Two child born has character of A blood group and rh positive, but the other child is A blood grouped and rh negative.

So the mother ought to be heterozygous with respect to Rh group, but she is homozygous with respect to blood group.

So her genetic setup is IAIARr.

4 0
3 years ago
Other questions:
  • Dated to approximately 500,000-400,000 years ago, the site of _______ has yielded a sample of 4,000 fossil fragments representin
    15·1 answer
  • PLZZZ HELPPP MEEEE !!!!
    6·1 answer
  • An individual sustains injuries to only the ascending tracts of the spinal cord. Will this person experience deficits in movemen
    8·2 answers
  • In an experiment, the factor that we measure is called the ​
    7·1 answer
  • Please help me asap!!!!!
    8·1 answer
  • How might nutrition and exercise influence whether or not an individual develops a disease for which they have an inherited high
    5·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Which of the following is not a function?<br> A. y = [x]<br> B. y = x2<br> C. x = 4<br> D. y = 3
    7·1 answer
  • Smaug is angered early in the chapter when
    10·1 answer
  • What five conditions are necessary to maintain genetic equilibrium
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!