B. all eukaryotic cells
hoped this helped!
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
It is referred as <span>parasitism</span>
Crossing over is termed as a process by which genetic materials are exchanged by non-sister chromatids during meiosis.
Crossing over results in the new combination of information in genetic for, the cell for a specific trait.
It ensures that organisms are identical from one generation to another. Genetic recombination allows variations in genetic materials which are passed through generations.
Answer:
For an individual who is heterozygous for two genes, Aa and Bb, what does independent assortment predict? Offspring inheriting the recessive allele
of the first gene will also inherit the dominant
Explanation:
Aa x Bb= AB, Ab, aB and ab
so the first gene will also inherit the dominant gene
