1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GenaCL600 [577]
3 years ago
6

Which structures protect the cell? Check all that apply.

Biology
2 answers:
ch4aika [34]3 years ago
8 0

Answer:

Cell wall.

Cell membrane.

:)

Komok [63]3 years ago
6 0

Answer:

Golgi body

cell wall

ribosome

nucleus

Explanation:

You might be interested in
What can neither be created nor destroyed by ordinary means?
MAVERICK [17]
Energy can be converted from one form to another, but it cannot be created or destroyed in ordinary chemical or physical means. It states that matter can be neither created nor destroyed in ordinary chemical or physical changes.
5 0
4 years ago
Read 2 more answers
What is the human genome project?
gogolik [260]

Answer:

The Human Genome Project was an international scientific research project with the goal of determining the base pairs that make up human DNA, and of identifying and mapping all of the genes of the human genome from both a physical and a functional standpoint

3 0
3 years ago
Read 2 more answers
A competent bacterial strain with genes a, b, and c is transformed by a donor bacterial fragment. Cotransformation frequencies f
mina [271]

Answer:

a) Genes b and c are farthest apart.

Explanation:

Transformation occurs when a competent bacteria cell takes up genetic material from the environment. Usually a donor cell donates its gene fragment  which is then incorporated into the chromosome or plasmid of recipient bacterial cell.

Cotransformation occurs when two genes are taken up together by the recipient. The closer the genes lie to each other, more are the chances of them being taken up together. Contransformation frequency will be higher if two genes are close to each other. Here, cotransformation frequencies between three genes are given. Amongst them, the lowest frequency is 0.0064% which is present between gene b and c. Hence, gene b and c are the farthest apart.

4 0
3 years ago
Explain the difference between a pure substance and a homogeneous mixture
Aleks [24]
Matter can be broken down into two categories: pure substances<span> and </span>mixtures.Pure substances<span> are further broken down into elements and compounds. ... A chemical </span>substance<span> is composed of one type of atom or molecule. A </span>mixture<span> is composed of different types of atoms or molecules that are not chemically bonded</span>
4 0
4 years ago
Read 2 more answers
Item 1
chubhunter [2.5K]
The Answer is C Gas exchange take place in our lungs
8 0
3 years ago
Other questions:
  • Which is an advantage of sexual reproduction over asexual reproduction? A) increased number of organisms and decreased genetic v
    13·1 answer
  • Suppose that you have a solution of 8% sugar water in a bag. The bag is semi-permeable: water molecules can pass into and out of
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • ¿Qué es la Cordillera del Atlántico Medio?​
    15·1 answer
  • The brightest star in the universe, a supernova, is thought to be about a million times brighter than our own Sun. If Polaris, l
    7·1 answer
  • The opening of a _______ channel is controlled by the binding of some molecules to the channel.
    15·1 answer
  • If you wanted to alter the structure of a bottom-up community, your best bet would be to A) remove the top predators. B) remove
    10·1 answer
  • Species A became extinct about 200,000 years before Species B evolved. Both species lived in the same location. In which
    12·1 answer
  • Select the correct answer from each drop-down menu.
    13·2 answers
  • Which of the following best describes Pangaea?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!