1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BartSMP [9]
3 years ago
11

En el enlace covalente entre azufre y carbono (6 y 4 electrones en su ultima capa respectivamente) la molécula tendrá ?

Chemistry
1 answer:
d1i1m1o1n [39]3 years ago
6 0

Answer:

a- Uno de carbono y dos de azufre

Explanation:

El compuesto formado entre el carbono y el azufre es CS2.

El carbono forma dos enlaces dobles con dos átomos de azufre.

Por lo tanto, el compuesto contiene un átomo de carbono y dos átomos de azufre.

You might be interested in
The rate at which an electrical device converts energy from one form to another is called what
zlopas [31]
It is called a watt and or wattage
7 0
3 years ago
Please help me with chemistry
vodka [1.7K]

Table Giving Answer

Element Atomic mass % Amount

Mg_24     24                79    18.96

Mg_25 25                10    2.5

Mg_26 26                11   2.86

   

Total                     24.32

Discussion

The method of calculation for this table, which was done in Excel (a spread sheet) is shown below. Assume that there is 100 grams of material of "pure" magnesium. What is it's mass?

<em><u>Sample  Calculation</u></em>

The the sample atomic mass = 24

Mass = % * sample atomic mass

Mass = 79% * 24

Mass = (79/100) * 24

Mass = 18.96

<em><u>Note</u></em>

The other two elements are found exactly the same as the sample calculation.

Then all you do is add the 3 masses together.

Answer

The mass of Mg to 1 decimal place is 24.3 <<<< Answer.


7 0
3 years ago
The chemical equation of rusting of iron is given
artcher [175]

Answer:

{ \tt{(a). { \bf{reactants : { \tt{iron \:  and \: oxygen}}}}}} \\ { \bf{products :  { \tt{iron(iii)oxide}}}} \\  \\ { \tt{(b).}} \: { \bf{1.204 \times  {10}^{24}  \: atoms}} \\ { \tt{(c).}} \: { \tt{4Fe +3 O _{2}  → 2Fe _{2}O _{3}}} \\  \\ { \underline{ \blue{ \tt{becker \: jnr}}}}

6 0
2 years ago
Write the molecular formula for the compound that exhibits a molecular ion at M+ = 112.0499. Assume that C, H, N, and O might be
navik [9.2K]

Answer:

C₆H₁₀NO

Explanation:

In order to arrive at a molecular formula we have to make some assumptions and they are

Assuming there is one ( 1 ) N and one ( 1 ) O that is present in the said molecule

Total mass =   29.998

next step: subtract the total mass from 112.0499 = 82.501

next : assume the presence of 6 carbon atoms in said molecule

Total mass =  6 * 12 = 72

Mass of Hydrogens = 82.501 - 72 = 10.501

∴ number of hydrogens = 10.501 / 1.0078  ≈ 10

Hence Total mass = 29.998 + 82.501  ≈ 112.0499

Finally Molecular formula = C₆H₁₀NO

3 0
3 years ago
Why do we use the term formula unit for ionic compounds instead of the term molecule?
Sloan [31]
<span>Ionic compounds form crystal lattices, not molecules. The term formula unit is used to indicate the simplest whole-number ratio of ions in the compound.</span>
3 0
3 years ago
Other questions:
  • Water can be formed from the synthesis reaction of hydrogen with oxygen<br><br> PLEASE HELP
    14·1 answer
  • For the following reaction, 142 grams of silver nitrate are allowed to react with 22.3 grams of copper . silver nitrate(aq) copp
    10·1 answer
  • _______ rock can be changed directly into _______ rock with the application of heat and pressure.
    8·1 answer
  • Iron (Fe) has three isotopes. Calculate the average atomic mass of the element Fe using the following data: Isotope atomic mass
    7·1 answer
  • Which type of atom has the strongest attraction for electrons in bond formation
    15·1 answer
  • How to find how many electrons are in an element
    12·1 answer
  • A scientist has a new cough medicine by giving it to a group of course the scientist gives another group called the liquid and t
    10·1 answer
  • 1. Gases are made up of molecules which are relatively far apart.
    14·1 answer
  • Elements can be described by various properties, and identified by their boiling and melting points. For example, gold melts at
    15·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!