1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
CaHeK987 [17]
3 years ago
15

What is everyone's view on time travel? Easy points. :)

Biology
2 answers:
Mandarinka [93]3 years ago
7 0

Answer:

In my opinion time is something which does not exist, actually everyone in this world has time differently, for them it all depends on relativity.

Time travel may be possible one day but we are very far from it.

MrMuchimi3 years ago
6 0

Answer

you Could fix any problem that happened but what would would happen if that solution became a problem so you wouldn’t fix the first problem so it’s still a problem so for every problem you would have it would keep repeat

Explanation:

The Luminatie!!!,!,!,!!!

You might be interested in
PLS HELP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! THIS ONE IS FOR 20 POINTS. I will also give you the brainiest points?!!!!!!!!!!!wha
nataly862011 [7]

Answer:

Cytoplasm

Explanation:

Happy to help

Pls mark as Brainliest.

6 0
3 years ago
Which organelle in the plant cell makes glucose from sunlight?
vovangra [49]

Answer: mitochondria

Explanation:

3 0
3 years ago
What letter is assigned to the original ( parent ) generation of true breeding plants used in Mendel's experiments?
serious [3.7K]
The answer is B: P

in which the P stands for Parent generation

hope this helped!

p.s. if you found this helpful please mark my answer as brainliest! it would mean a lot to me, thanks!
3 0
3 years ago
Read 2 more answers
What will happen if external factors affect cell division in a group of cells placed in a culture dish
cluponka [151]

Answer:

The effect of an external physical factor on cell division is clearly seen in density-dependent inhibition, a phenomenon in which crowded cells stop dividing. ... When cells have formed a complete single layer, they stop dividing (density-dependent inhibition).

Explanation:

7 0
3 years ago
A _____ is not a living thing. it is made of genetic material inside a protein coat. eukaryote domain bacterium virus
Bumek [7]
A virus is not a living thing. It is made of genetic material inside a protein coat. A virus is a small infectious agent that replicates only inside the living cells of other organisms. Viruses can infect all types of life forms, from animals and plants to microorganisms, including bacteria and archaea. It is an infective agent that typically consists of a nucleic acid molecule in a protein coat, is too small to be seen by light microscopy, and is able to multiply only within the living cells of a host. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • Scale Piots.
    12·2 answers
  • What are the consequences of high levels of fertilizing chemicals in water?
    14·1 answer
  • Mr. whitaker is 5'8", weighs 145 pounds, and has been diagnosed with esophageal cancer. his hematocrit is 28 percent and his alb
    9·1 answer
  • List the ten major biomes in the world
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Explain how deposition in a basin leads to the formation of sedimentary rock
    10·1 answer
  • PLS!!!!!!!!HELP!!!!!!!
    10·1 answer
  • The neurotransmitter acetylcholine
    5·1 answer
  • The word parasitism comes from the Latin word meaning take another's food.<br> True<br> False
    10·1 answer
  • When many minerals are formed from where as water?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!