1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
3 years ago
9

A sample of gas occupies 1.2 L at 12.0oC. Assuming pressure remains the same, what would be the volume (in L) of this gas at 67o

C?
A.
1.4

B.
1.0

C.
0.2

D.
5.0

E.
6.7
Chemistry
1 answer:
Levart [38]3 years ago
4 0

Answer:

e.

6.7

hope it help

.

.

.

.

.

.

You might be interested in
That's just the tip of the iceberg" is a popular expression you may have heard. It means that what you can see is only a small p
puteri [66]
Answer:

B 1.23 g/cc

Explanation:
For something to float on seawater, the density must be less than 1.03 g/mL. If the object sinks, the density is greater than 1.03 g/mL.

Let’s examine the answer choices. Keep in mind, the ice berg is mostly below the water level.

A. 0.88 g/cc
This is less than 1.03 g/cc, which would result in floating.

B. 1.23 g/cc
This is the best answer choice. The iceberg is mostly beneath the water, but some of it is exposed. The density is greater than 1.03 g/mL, but not so much greater that it would immediately sink.

C. 0.23 g/cc
This is less than 1.03 g/cc, which would produce floating.

D. 4.14 g/cc
This is much greater than 1.03 g/cc and the result would be sinking.
5 0
3 years ago
Describe the changes that earths atmosphere has gone to overtime
irakobra [83]

Answer:

Over a vast amount of time, millions of years, the earth gradually cooled. When the temperature dropped enough, water vapor condensed and went from a gas to liquid form. This created clouds. From these clouds, the oceans formed and the oceans absorbed a lot of the carbon dioxide in the atmosphere.

Explanation:

8 0
3 years ago
Write BALANCED reactants & products in words and symbols for 3
Amiraneli [1.4K]
Hard question thx for the points
3 0
3 years ago
What is the empirical formula for propene (C3H6)?<br> C2H4<br> C4H8<br> C3H6<br> CH2
melamori03 [73]

Answer:

C3H6

Explanation:

please mark me as brainlest

8 0
3 years ago
Read 2 more answers
What is the maximum amount of kcl that can dissolve in 200 g of water? (the solubility of kcl is 34 g/100 g h2o at 20°c.)?
Svetllana [295]
The correct answer is 68 g
hope this helps!!
8 0
3 years ago
Read 2 more answers
Other questions:
  • An atom of 14 6 c carbon decays by gamma decay which atom is left after the decay
    15·2 answers
  • Without doing any calculations, which transition in the hydrogen atom has the shortest wavelength?
    6·1 answer
  • The pressure of gas is affected by the number of particles and is not affected by the kind of gas in the container. What does th
    13·1 answer
  • an ------ model with dark bands representing energy levels shows where an atoms electrons are most likely to be.
    11·1 answer
  • Identify the Lewis acid in this balanced equation:
    6·2 answers
  • Molecular chlorine and molecular fluorine combine to form a gaseous product. Under the same conditions of temperature and pressu
    5·1 answer
  • urgent please help!!!!!! Which factors add to the greenhouse effect and are caused by human activities? Select two options. a de
    15·1 answer
  • Determine the pH at the point in the titration of 40.0 mL of 0.200 M H₂NNH₂ with 0.100 M HNO₃ after 100.0 mL of the strong acid
    11·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • What are some ways that scientists use to model chemical reactions?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!