1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cupoosta [38]
3 years ago
8

I need help please I’m on the last question on my ixl and I don’t want to mess up

Biology
1 answer:
babymother [125]3 years ago
7 0

Answer:

top one is mountain range

Explanation: I think

the bottom one is Continental crust

You might be interested in
Is a grasshopper a heterotroph or autotroph?
Fed [463]
Is a heterotroph because he doesn't reproduce food itself
8 0
3 years ago
What is atomic radii
valentina_108 [34]
The atomic radius of a chemical element is a measure of the size of its atoms, usually the mean or typical distance from the center of the nucleus to the boundary of the surrounding cloud of electrons.
3 0
3 years ago
Compare the process of the distal tubule to the proximal tubule
saul85 [17]

Answer:

Proximal tubule is involved in reabsorption from blood to filtrate while Distall tubule is also involed in secretion from blood to filtrate.

Explanation:

Proximal Tubule;

It reabsorbs the important nutrients such as water, sodium, potassium, calcium, glucose, aminoacid etc. from the filtrate and send them back into the bloodstream.

Distal tubule;

Although distal tubule is involved in reabsorption of nutrients such as calcium, sodium chloride but it is also in secretion of blood wastes such as drugs into the filtrate. It also help in maintaining the pH of blood by secreting the protons into filtrate and absorbing the bicarbonate ions.

5 0
3 years ago
How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGG
Katen [24]

Answer: 7

Explanation: During translation, several codons have special functions which they serve. AUG is called the initiation codon, it signals the beginning of polypeptide synthesis and also codes for methionine in the internal positions. UAA, UAG and UGA are called termination codons because they do not code for any known amino acid. They signal the end of a polypeptide synthesis.

Each codon is made up of three nucleotides. The number of codons between the initiation codon UAG and the termination codon UGA in the mRNA is seven, thereby encoding seven amino acids.

See the attached diagram for further illustration.

4 0
3 years ago
Using Image A, which number represents the structure in which
Svetradugi [14.3K]

Answer:

13

Explanation:

In plants, photosynthesis takes place in chloroplasts, which contain the chlorophyll. Chloroplasts are surrounded by a double membrane and contain a third inner membrane, called the thylakoid membrane, that forms long folds within the organelle

6 0
3 years ago
Other questions:
  • During osmosis, the semi-permeable membrane is one that: A. allows only very small particles or water through. B. allows only ve
    10·1 answer
  • HELP!!! A population of jellyfish has shown a sharp decline. What types of factors should be investigated? (The last answer was
    8·1 answer
  • What would happen if s-phase did not occur before mitosis?
    12·1 answer
  • Why are kelp forests considered important to our understanding of marine ecosystems?
    8·2 answers
  • If the tube incubated at 100°C was placed back in the optimum temperature, would a reaction occur?
    7·1 answer
  • What type of farming is particularly harmful?
    15·1 answer
  • Help mee guy to complete this please please please please please​
    8·2 answers
  • Does anyone know something that I could do to help myself focus bcs I have ADD and I'm failing?
    12·2 answers
  • Describe the ways in which water in sewage polluted lake and water from the sea are
    10·1 answer
  • As we know three most common house hold fuse value sare 3A,5A and 13A.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!