1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
asambeis [7]
2 years ago
13

What's poppin BOiiiiiiiiiiiiiiiiiiiiiiiiis virtuial hugs to all

Biology
2 answers:
vlabodo [156]2 years ago
5 0

Answer:

WASTING MY POINTSSS

Explanation:

AHAHAHAHAHA

r-ruslan [8.4K]2 years ago
4 0

Answer:

hug me daddy now please mucho

You might be interested in
43) When the baroreceptor reflex is triggered by a decline in blood pressure,A) peripheral resistance decreases.B) sympathetic a
White raven [17]

Answer:

I believe it's A and B

Explanation:

Hope my answer has helped you!

6 0
3 years ago
The ____________ functions as a gateway through which chemicals and small particles, such as ____________ enter or leave the cel
Vilka [71]

Answer: cell membrane

such as water, micro-organism

physical process

simple diffusion, osmosis and filtration

such as potasssium permaganate in water,urea a liver waste diffuses from the body and the kidney help in filtering it out

physiological processs

active transport, phagocytosis and pinocytosis

such as soduim-potassium pump, exocytosis

Explanation:  transportation in and out of cell is done in different ways listed above but a barrier to this movement is the cell membrane which is an outer covering of the cell. it protect the cell and only some materials can penetrate the cell membrane e.g micro-organism, water e.t.c. the various physical and physiological processes are the various ways substance  cna be liquid, solid or gas are transported within or outside the  cell e.g food

6 0
3 years ago
Which is a characteristic of pseudoscience?
lakkis [162]

Answer:

Resistance to change

Explanation:

Indicators/Characteristics of pseudoscience:

  • Use of vague, exaggerated, or untestable claims
  • Over-reliance on confirmation rather than refutation
  • <u>Lack of </u><u>openness </u><u>to testing by </u><u>other experts</u>
  • <u>Absence </u><u>of </u><u>progress</u>
  • Personalization of issues
  • Misleading language

6 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
A gel-like substance enclosed by the cell membrane that contains th cells organelles
almond37 [142]
The answer is cytoplasm 
cytoplasm is a gel in the cell and contains the cells organelles :)))
i hope this is helpful
have a nice day 
4 0
3 years ago
Other questions:
  • When a portion of the sample does not respond to the survey?
    5·1 answer
  • Which of these is an example of a chemical change?
    7·2 answers
  • How many different possible codon combinations are possible using the three letter alphabet of DNA
    10·1 answer
  • Wolves and lions are at the same trophic level because they both...
    13·2 answers
  • When is genetic drift a major factor in evolution?
    6·2 answers
  • What is the major cause of phytoplankton blooms in the Gulf of Mexico?
    8·1 answer
  • ANSWER THIS PLZ ASAP
    6·1 answer
  • g RNA synthesis complexes containing DNA, RNA, and polymerase perform RNA synthesis (tRNA, mRNA, and rRNA) takes place in comple
    7·1 answer
  • I need help with this question
    11·1 answer
  • CAN SOMEONE TELL ME please
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!