1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rom4ik [11]
3 years ago
7

Choose the correct answer from the choices below

Chemistry
1 answer:
marusya05 [52]3 years ago
3 0

Answer:

either h or j

Explanation:

You might be interested in
Use the periodic table to answer the following question. What is the predicted order of first ionization energies from highest t
Degger [83]

B. Be > Mg > Ca > Sr

6 0
3 years ago
Read 2 more answers
Two different atoms have four protons each and the same mass. However, one has a positive charge while the other is neutral. Des
seraphim [82]

The possible number and location of all subatomic are one of them is electrically neutral, while the other has a stable electronic configuration.

<h3>What are subatomic particles?</h3>

Subatomic particles are those particles that are present inside the atoms. They are electron, neutron, and proton. They are charged particles, protons are positively charged, electrons are negatively charged and neutrons are neutral.

The protons and electrons totally contribute to the atomic mass of the elements.

Thus, the subatomic particles are electrically neutral and stable to electronic configurations.

To learn more about subatomic particles, refer to the below link:

brainly.com/question/13303285

#SPJ1

8 0
1 year ago
Which statement describes a reason to consider air a mixture? A) The major constituents of air are gaseous elements. B) The comp
umka21 [38]

The correct answer is - A) The major constituents of air are gaseous elements.

With the statement ''the major constituents of air are gaseous elements'' we can easily conclude that the air is a mixture. The reason for that is that we have a plural usage of the word element, elements, which mean that there are multiple elements that make up the air.

The air is indeed predominantly a mixture of gaseous elements. The most abundant gas in the air being the nitrogen with 78.9%, oxygen with 20.95%, argon 0.93%, and carbon dioxide 0.04%, with lesser amounts of other gases also be present in it. The water vapor is also present in the air, though it is variable, being around 1% at sea level, but only 0.4% over the entire atmosphere.

3 0
4 years ago
Which of the following statements is true? Radiation is the transfer of heat between objects which are not touching. An insulato
Licemer1 [7]

Answer:

Radiation is the transfer of heat between objects which are not touching. I think

Explanation:

3 0
2 years ago
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Other questions:
  • What is a problem commonly associated with nuclear power facilities?
    11·1 answer
  • Why is rusted iron an example of an oxidation–reduction reaction? electrons are exchanged?
    8·2 answers
  • The bromination of acetone is acid-catalyzed.CH3COCH3 + Br2 CH3COCH2Br + H+ + Br -The rate of disappearance of bromine was measu
    14·1 answer
  • If 200 ml of 0.15 M propionic acid (PA) is added to 300 ml of 0.02 M NaOH, what is the resulting pH of the solution? Round the a
    7·1 answer
  • Help me please for brainliest and 10 points.
    10·1 answer
  • Beginning
    11·1 answer
  • ASAP I WILL GIVE BRAINLIEST!Which arrow represents the change of state described above? The diagram shows changes of state betwe
    8·1 answer
  • Why do people say air is a poor conductor , but isn't conduction happens in solid?​
    11·1 answer
  • A solution is made by dissolving 15.0 mL of oil in enough gasoline to give 50.0 mL of solution. What is the % (v/v) of oil in th
    12·1 answer
  • Magnesium reacts with acid to give a salt
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!