1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
patriot [66]
3 years ago
11

What part of the male and female reproductive systems is responsible for producing gametes?

Biology
2 answers:
fgiga [73]3 years ago
8 0

Answer:

gonads

Explanation:

Hope this helps :)

Mashcka [7]3 years ago
3 0

Answer:

Gonads

Explanation:

The reproductive system is the human organ system responsible for the production and fertilization of gametes and, in females, the carrying of a fetus. Both male and female reproductive systems have organs called gonads (testes in males, ovaries in females) that produce gametes (sperm or eggs) and sex hormones (such as testosterone in males and estrogen in females).

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Which molecule is less soluble in water--a fat or a phospholipid? Why?
VladimirAG [237]
Fat is less soluble in water compared to phospholipids.
This is because, fat is made up of three molecules of fatty acids which are not polar in nature at all, thus they mixed very poorly with water.
Phospholipids on the other hand has its molecules divided into two distinct regions, the head and the tail region. The head region is hydrophillic and it is polar in nature, that is, it mixes well with water. The tail region is made up of the fatty components  and it is hydrophobic.
Because of this difference in structure, phospholipid will dissolve better in water.
4 0
4 years ago
Read 2 more answers
Is a highly addictive stimulant with dental damage as a telltale sign of its use; it causes users to experience serious side eff
Agata [3.3K]
Your answer is meth. ☆
5 0
3 years ago
_____ are related to poor productivity of harvest due to poor care for soil.
Marrrta [24]

Answer:

Soil Tillage, Climate Change and Soil Carbon Sequestration

Explanation:

7 0
3 years ago
Urgent please answer
svetlana [45]

Answer:

1) It's called taxonomy

2) There are 7

3) The basic difference between them is Monera are unicellular and prokaryotic cellular structures, whereas Protista are unicellular and eukaryotic cellular structure. Cell organelles are absent in Monera, but Protista is well-defined and has membrane-bound organelles.

4) Reptiles and Fish belong to kingdom Animalia

4 0
3 years ago
Other questions:
  • Photosynthesis is to chloroplasts as cellular respiration is to ______.
    15·2 answers
  • Segments of DNA transferred from parent to offspring are called
    6·2 answers
  • Which describes simple diffusion
    6·1 answer
  • An extreme disturbance happens in an ecosystem. How does an ecosystem change as succession happens after this disturbance?
    8·2 answers
  • Show me a picture of telophase stage of mitosis
    11·1 answer
  • The ability to have an advantage in obtaining mates by having bigger antlers in deer or bigger showy tails in peacocks, for exam
    12·1 answer
  • What are these chromosomes consideredas?
    11·2 answers
  • What struggles do aquatic organisms have that terrestrial ones do not?
    11·2 answers
  • Which of the following is a way that nitrogen atoms move from a nonliving part of the environment into a living part of the envi
    6·2 answers
  • 49. How is air drawn into the body?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!