The air pressure. the air pressure increases as the altitude an object is at increases.
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
<span>False. Foods that allow microorganism to grow are not called parasites. Parasites are organisms that feeds on the nutrients of its host.
For example leeches. They suck on our blood.
</span>Foods that allow microorganism to grow are called <span>potentially hazardous foods. They are high in protein and moisture and are slightly acidic.
For example hamburgers. They are high in protein and moisture.</span>
Answer:
Electricity. Coal alone provides half the electricity in the United States. ...
Heating. Oil and natural gas are commonly used for heating homes as well as providing heat for industrial applications.
Transportation. Oil supplies 99 percent of the energy for cars in the form of gasoline and diesel. ...
Limits. ...
Considerations.
Explanation:
