1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AVprozaik [17]
3 years ago
12

1. What is a chemical reaction?

Chemistry
1 answer:
atroni [7]3 years ago
6 0

a chemical reaction is a process in which one or more substances, also called reactants, are converted to one or more different substances known as products. a chemical reaction rearranges the constituent atoms of the reactants to create different substances as products

You might be interested in
How many hydrogen grams can be obtained if
kipiarov [429]

hi im breanna

Answer:

The mole is simply a very large number that is used by chemists as a unit of measurement.

Explanation:

The mole is simply a very large number,  

6.022

×

10

23

, that has a special property. If I have  

6.022

×

10

23

hydrogen atoms, I have a mass of 1 gram of hydrogen atoms . If I have  

6.022

×

10

23

 

H

2

molecules, I have a mass of 2 gram of hydrogen molecules. If I have  

6.022

×

10

23

 

C

atoms, I have (approximately!) 12 grams.

The mole is thus the link between the micro world of atoms and molecules, and the macro world of grams and litres, the which we can easily measure by mass or volume. The masses for a mole of each element are given on the periodic table as the atomic weight. So, if have 12 g of  

C

, I know, fairly precisely, how many atoms of carbon I have. Given this quantity, I know how many molecules of  

O

2

are required to react with the  

C

, which I could measure by mass or by volume.

5 0
3 years ago
Nearly all the energy from the earth receives from the sun is used in photosynthesis
dezoksy [38]

Answer: It is false because we use alot of it to with solar power.

4 0
3 years ago
BTW IT IS SCIENCE
Sliva [168]
The answer is A warm air rises cool air sinks

4 0
3 years ago
Read 2 more answers
What does the poitof incidence mean?​
Lemur [1.5K]

Answer:

Point of incidence: The point on the surface where the incident ray strikes the surface is called the point of incidence. Reflected ray: The ray of light that bounces back from the surface of an object is called a reflected ray of light.

Explanation:

Search

4 0
3 years ago
Under ordinary conditions of temperature and pressure, the particles in a gas are
vova2212 [387]
<span>In normal conditions gas particles remain very distant from each other. They rarely collide and are stable. When temperature increases the gas particles begin to move faster and collide more, reducing the distance. When pressure increases the gas particles also pick up kinetic speed and are also closer to each other.</span>
4 0
3 years ago
Other questions:
  • What are the most enzymes in the body?
    5·1 answer
  • how many moles of CO2 form when 58.0 g of butane, C4H10, burn in oxygen? 2C4H10+13O2---&gt;8CO2+10H2O
    9·2 answers
  • What term best defines the splitting of nuclei into smaller fragments due to the bombardment of neutrons?
    10·1 answer
  • Hormones taken as medicine can harm fish when the hormones end up in waterways. What does this show about the impact of chemical
    11·1 answer
  • The molecule h2so4is ionized to h+ ions and so4- ions in water. would you predict this to result in a solution that is acidic or
    14·1 answer
  • How many grams of calcium nitrate are needed to make 3.30 L of a 0.10 M solution?
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • A sample of metal had a mass of 17.29g and a volume of 5.68mL what is the density of this metal
    8·1 answer
  • Name the following compound: H₂SO₄ *
    6·2 answers
  • How many moles are in 8.32 × × times 10^24 molecules of co2?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!